10M PCR tests ending in August and zero evidence of asymptomatic spread.

I think I recall Fauci saying this exact thing at the start of all this.

Who convinced you otherwise?
A few excerbs ...
Kids and teachers rates are amount the lowest.

It’s as if it’s Opposite Day in the central planners office.

Stuff C19 into nursing homes and torture the least at risk population in schools?

All reinfections were non-infectious on viral culture.
Notice the use of ORF1a and N primers.

Lots of labs with a tight cold chain.
CQ37 as a cutoff with retests at 37-40
Burried in the supplement are the Ct values.
Notice the ORF1a CQ is closest to N CQ in kids. This suggest sgRNA/gRNA balance.
As the population ages these CQ diverge with less ORF1a signal and more N signal (lower CQ).
It’s subtle but with these numbers may be significant.
Weaknesses.
The method sections are laughably incomplete. No cell line or culture conditions are described.
The qPCR spells out the primers but not the cycling conditions, set up or prep. Might be messy across 63 labs.

Benfords Law?
Excel sheet in supp.

en.m.wikipedia.org/wiki/Benford%2…
A few things to consider. Most testing was done in the spring-summer. Asymptomatic spread might be more possible in the winter?

This region is believed to have high levels of pre-existing immunity due to other HCoVs in circulation.

See @gummibear737 and @boriquagato work
It is important to steal man papers that have this much gravity to them.
1)The exceptionally low false positive rate across 63 labs is hard to believe given this was 10M tests done in 19 days.

The Broad/MIT is doing 100K/day. Ive heard they are 5% of US capacity.
They did run IgG and IgM to confirm qPCR positives but overall low positive of qPCR was impressive.

Naturally I'm interested in their qPCR protocol and there isn't much to be found here. Just the primer sequences, not methods. This is a major weakness of the paper.
A quick glance at the numbers of tests run and just about every data set in the supplement (all of which are sparse) doesn't fit Benford's law.
Meh, not a smoking gun but makes you dig deeper.
en.wikipedia.org/wiki/Benford%2…
Nature has links to the communicating authors prior publications. 2 of the Comm authors have only 2020 papers on SARs?
The more senior authors have more but I'm seeing the words correction alot?
These are the primers from the paper.
>Cao_10M_N_F
GGGGAACTTCTCCTGCTAGAAT
>Cao_10M_N_R
CAGACATTTTGCTCTCAAGCTG
>Cao_10M_N_Probe
TGCTGCTGCTTGACAGATT
>Cao_C10M_Orf1_F
CCCTGTGGGTTTTACACTTAA
>Cao_010M_orf1_R
ACGATTGTGCATCAGCTGA
>Cao_10M_Orf1_P
CCGTCTGCGGTATGTGGAAAGGTTATGG
Not fond of the homology to Rhesus, Human, Horseshoe Bat etc...
I dont see any pair land in proximity with a probe but the long match with human really begs for more transparency on the PCR methods in light of such outlier FPRs. They did employ a 37CQ screen and rerunning >37.
^have 2020 publications NOT on SARs

Lead author has 2 other papers. One author from U East Anglia with 0 Pubs but this one.
Missed the rhesus link

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Kevin McKernan

Kevin McKernan Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @Kevin_McKernan

21 Nov
This Story begins with Cancer and Ends with Psilocybe cubensis.

It is a very timely topic given the lockdown induced suicide, anxiety and depression.

In fact, Psilocybin has been awarded FDA breakthrough status for these very things.
medscape.com/viewarticle/92…
Johns Hopkins has looked into this in Terminal Cancer Depression.
archpsyc.jamanetwork.com/article.aspx?a…
thelancet.com/pb/assets/raw/…

It is time to take a deep dive
but first the Cancer story

In 2016, I became a green thumb on a mission. My father had stage4 bone mets with BRAF:K601E mutations
While cannabinoids were unmatched by western medicine for cancer related cachexia, pain and nausea, there was an added hopeful kicker; Cannabinoid were non-toxic potent AKT1 inhibitors. Just what the Foundation medicine report called for ...except they had to stick to FDA drugs.
Read 25 tweets
21 Nov
When asked “where did flu go?”

Having run a CLIA lab, you must follow the Gordian knot of CPT codes and liability.
Hospital Acquired Infections (HAI) often fall on the hospital to cover.

Flu has risk of HAI
C19 is liability free.

Admin gonna admin.

ama-assn.org/practice-manag…
It will be interesting to see the adoption of multiplex testing where Flu and C19 are tested in parallel.

A few papers that use these kits see 1:300 co-infection rates.

Now have CPT codes for mux testing.

ama-assn.org/practice-manag…
Assays for multiplex testing are here.

watermark.silverchair.com/jiaa658.pdf?to…
Read 5 tweets
13 Nov
What happens when you use RNA polymerase mutagens in your fight against a virus?

Life Finds a way. Mutations accelerate.
nejm.org/doi/full/10.10…
I’m just speculating on this. This is a great read on the types of polymerase errors this modified nucleotide tends to create.

Keep in mind the patient was on a lot of drug including HCQ so this one patient study won’t answer this.
From the supplement.
Poor soul had a rough fight.
Read 4 tweets
13 Nov
This genome was Crypto funded and Crypto peer reviewed.
Project published in 5 months.

Decentralized funding and peer review seemed crazy in 2018. If you recall Surgisphere, you might appreciate censorship resistant science.
osf.io/7d968/
@saifedean
@JamesTodaroMD
We presented on this Crypto Incentivized Blockchain recorded Review (CIBR) concept @TexasBitcoin in 2018. It foreshadows much the censorship and distortion of science seen in C19.

We propose as solution that introduces price signals and free markets.

Many people cringe at $ in peer review.
Meanwhile Journal publication prices continue to rise while digital content distribution costs fall.

The $ in peer review should go to the people doing the most valuable work (review). Free work generates errors.

medicinalgenomics.com/cryptocurrency…
Read 5 tweets
13 Nov
Freedom Requires Live-Dead analysis: Subgenomic RNA

You need to pay attention to Wolfel et al and Kim et al.

A very elegant method for Live-Dead analysis.

But before we dive into that Mol-Bio hole, you must see the gravity of Liotti’s work.

jamanetwork.com/journals/jamai…
Liotti (&Wolfel) demonstrate that your infectious stage is above 1-2M RNA copies/ml and usually lasts 5 days. However non-infectious RNA can last 77 days. To be safe they suggest 10 days and 100,000 copies/ml as non-infectious.
So what is creating the long tail of qPCR positivity that is not infectious.

This is believed to be due to subGenomic RNA. Kim et al has the best review on this.

ncbi.nlm.nih.gov/pmc/articles/P…
Read 23 tweets
12 Nov
Inside and Outside of kids cloth mask worn all day at school.
Plated on PDA with no selection.

Central planning and it’s effect on evolution and anti-fragility?
If 7B people all wear 300um filters that collect microbes, the human microbiome will change. Is this Good or bad? ImageImage
In order for one to identify the microbes. ITS/16S sequencing or whole genome sequencing is required.

We describe that in these manuscripts.

f1000research.com/articles/5-2471

f1000research.com/articles/4-1422 Image
Cannabis microbiomes are relevant to the mask debate as this is the study of microbes you might inhale and thus we are particularly sensitized to fungi that can cause aspergillosis or fusariosis.

Microbes that synthesize mycotoxins are important as well. Image
Read 9 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Too expensive? Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal Become our Patreon

Thank you for your support!

Follow Us on Twitter!