Thread by @BanfieldJill

1. I, Borg. Part 2 of the #BORG saga. Today we unveil 6 new polished genomes for BORGs, enigmatic non-living entities found in the microscopic universe of dark, cold, wet soil. We dived into their genomes to make discoveries regarding their unique tool sets. 🛠🧬

2. Jump to the paper:

bit.ly/3FZLstX

@MScholmerich
@BanfieldLab

3. BORGs exist within archaeal organisms that eat methane AND they have vast gene inventories. This raises the mystery of how BORGs function inside their host cells without causing complete chaos? 💥

4. BORGs are master assimilators that appropriate functions from their neighbors... yet they seem to... exist… in harmony with their hosts. Given their enormous size and complexity, there MUST be mechanisms to enable cohabitation 🕊

5. BORGs have numerous tandem direct repeats: unusual perfect DNA stutters that fit in the space between genes or within genes.

6. 👩🏽‍🔬💻 We’re sitting at our computers staring at code like this … TTATAGATAAAATTATAGATAAAATTATAGATAAAATTATAGATAAAATTATAGATAAAA
... could things like this be the key to the cohabitation riddle?

7. We know that the hosts are archaea that use a complex electrical network to dispose of electron waste left over from consuming methane... ⚡️⚡️⚡️

8. BORGs have many electron-carrying proteins (multiheme cytochromes), and some of these carry repeats. Repeats within proteins cause local structural disorder that likely becomes ordered when the repeat Borg proteins bind to partners.

9. When ported to the host cell surface, repeats may allow BORG derived cytochromes to slot into the host’s electric wiring network. ⚡️🔁⚡️

10. Imagine an alien, landing on Earth with intent to cohabitate. Their alien technology wouldn’t necessarily work natively with ours. In the same way, those repeats may be the adaptors that let the BORGs get to “plug in” to the host’s network! 🪝⛓

11. Let’s talk methods. It was necessary to polish these 6 new Borg genomes to completion to fully uncover the repeats because de novo DNA sequence assemblies often break in repeat regions or hide the repeats in misassemblies

12. It is another reminder of how careful curation of automated genome assemblies is essential to understand many facets of biology. It takes time, but it’s worth carefully LOOKING at the data! 👀👩🏽‍💻

13. You can’t put a turbocharger onto a steering wheel. Similarly, production of BORG proteins without regulation or direction could cause chaos. 💥🧬

14. Our work provides clues to how complex host and BORG biological systems are coordinated. This may be a more general phenomenon that has biotech applications 🔬👩🏽‍🔬🧪