Discover and read the best of Twitter Threads about #bbcinsidescience

Most recents (4)

The @DeepMind protein folding result is really incredible, and incredibly important. But I know it’s pretty tricky to understand, so here’s a megathread, with a bit of Biology 101, for @holland_tom @thehistoryguy
et al.

bit.ly/2JnKQoF
@DeepMind @holland_tom @thehistoryguy Here we go: Genes are long strings of molecules made up of an alphabet of four ‘letters’

e.g.

gacgaagagcccatgatcaacgac
@DeepMind @holland_tom @thehistoryguy Each triplet of letters encodes an amino acid (which we code as capital letters)

gac gaa gag ccc atg atc aac gac

translates to

D. E. E. P. M. I. N. D.
Read 16 tweets
Right, well I’ve got #COVID19 now, laid out for the last 24 with coughs, aches etc. Feels like a mild flu. Total isolation now, and be vigilant especially if you’ve had contact with me recently.
Thank you for all your lovely messages. We are withdrawing the kids from school, which they were ecstatic about until my son realised I am quarantined in the PlayStation room.
Update: A bit rough, but ok, my daughter much the same. It’s not much fun but we’ll be ok. Immunosuppressed or vulnerable people need to avoid this like the plague, and the only tactic that worked for the plague was quarantine.
Read 14 tweets
1. Listening to #BBCInsideScience with @AdamRutherford my colleague @clequere noted the UK had cut its CO2 by over 40% since 1990. However, include CO2 from aviation & shipping, along with our imports & exports & the UK's cut in its total carbon emissions is much nearer 10%.
@AdamRutherford @clequere 2. Much to this 10% cut is due to the banking crisis/recession along with coal closures driven by the EU's sulphur directive. Certainly the carbon price has had some impact along with renewable polices, but only at the margins. #BBCInsideScience @adamrutherfod @clequere
3. Full national carbon accounting sees the EU’s climate ‘progressive’ nations of France, Sweden &Denmark deliver almost no cut in CO2 since 1990. Still worse,several EU nations have presided over v.significant increases. As yet there are no good examples amongst wealthy nations.
Read 4 tweets
Dear all, A thread on bad science: The story doing the rounds about the identification of Jack the Ripper via DNA from a shawl is doing the rounds again.
1/n
It is predicated on the publication of this paper
bit.ly/2ULxp2Q
Which is the study first described in 2014 in a book and in the Mail on Sunday.
3/n
Read 16 tweets

Related hashtags

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3.00/month or $30.00/year) and get exclusive features!

Become Premium

Too expensive? Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal Become our Patreon

Thank you for your support!