Nate Silver Profile picture
Editor in Chief @SilverBulletin. Founder @FiveThirtyEight. Author 'On the Edge: The Art of Risking Everything' (out now).

Apr 22, 2024, 25 tweets

Plasmid DNA copy number quantification. protocols, reagents, and a thread of new results.

this is a map of the plasmid we sequenced from 2020 batches of mRNA vaccine.

we made a bunch of primer/probe pairs at IDT. here are the ones that worked the best.

SV40 FWD
TGTGGAATGTGTGTCAGTTAGG

SV40 REV
CACACCTGGTTGCTGACTAAT

SV40 PRB
/56-FAM/CCAGCAGGC/ZEN/AGAAGTATGCAAAGC/3IABkFQ/

Neo1 FWD
CGTTGGCTACCCGTGATATT

Neo1 REV
CTCGTCAAGAAGGCGATAGAAG

Neo1 PRB
/56-FAM/CCGCTTCCT/ZEN/CGTGCTTTACGGTAT/3IABkFQ/

Neo5 FWD
ACTGGGCACAACAGACAATC

Neo5REV
CCTCGTCTTGCAGTTCATTCA

Neo5 PRB
/56-FAM/TTTGTCAAG/ZEN/ACCGACCTGTCCGG/3IABkFQ/

pBR322-5 FWD
GTTTGTTTGCCGGATCAAGAG

pBR322-5 REV
CTAACTACGGCTACACTAGAAGAAC

pBR322-5 PRB
/56-FAM/TTCCGAAGG/ZEN/TAACTGGCTTCAGCA/3IABkFQ/

Spike1 FWD
CAGCTACCAGACACAGACAAA

Spike1 REV
GCGATAGAGTTGTTGGAGTAGG

Spike1 PRB
/56-FAM/AGCCAGAGC/ZEN/ATCATTGCCTACACA/3IABkFQ/

Spike N1 FWD
AGCCTACACCAACAGCTTTAC

Spike N1 REV
TGAAGAAAGGCAGGAACAGG

Spike N1 PRB
/56-FAM/CGACAAGGT/ZEN/GTTCAGATCCAGCGT/3IABkFQ/

we made a synthetic gBLOCK standard and ordered it from IDT. this is the quantification standard on which all our qPCR results rest. so it was critical to have a high-confidence quantitative standard. i trust the number IDT prints on the side of the tube for the quantity of gBLOCK delivered.

here is the sequence of the positive control gBLOCK in case you want to order it yourself. it is a frankenstein assembly of a bunch of potential target regions, with signature sequences added so that if we ever sequence we can easily tell the difference between authentic targets coming from the plasmid vs contamination with our positive control. we have no such contamination yet but thought ahead and made it so we could tell the difference (this is for people who carefully analyze the sequence below. you can just ignore all this and simply order as-is and use it.

CTACGTGAACCATCACCCTAATCAAGTTTTTTGAGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGATTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGtccatctgaagcgagtcgctTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTACCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCAACTCAATTAGTCAGCAACCAGGTGTGttcggaagatgccagtgtgaCGTTGGCTACCCGTGATATTGCTGAAGAACTTGACGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCACAGCGCATCGCCTTCTATCGCCTTCTTGACGAGaatggacagcgtttgcttaaCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGACTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGACCTGAATGAACTGCAAGACGAGGgccccaaagccctcgtagacCTACAGCGTGAGCTATGAGAAAGCGCCACACTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACAAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGagcatttcacgcgactagccGTTTGTTTGCCGGATCAAGAGCTACCAAATCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATAACAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGtagatctcttcctactagtcCAGCTACCAGACACAGACAAACAGCCCTCGGAGAGACAGAAGCGTGGCCAGCCAGAGCATCATTGCCTACACAATGTCTCTGGGCACCGAGAACAGCGTGGCCTACTCCAACAACTCTATCGCaaaatggcattagcgattgtACATCTGGCTGGGCTTTATCGCCGGACTGATTGCCATCGTGATGATCACAATCATGCTGTGTTGCATGACCAGCTGCTGTAGCTGCCTGAAGGGCTGTTGTAGCTGTGACAGCTGCTGCAAGTTCGACGAGGACGATTacaatcgtacgaaatggaggAGCCTACACCAACAGCTTTACCAGAGGCATGTACTACCCCGACAAGGTGTTCAGATCCAGCGTGCTGCACTATACCCAGGACCTGTTCCTGCCTTTCTTCAgcactctaatgcaaatgcagGATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACAGGCTGTGTGATTGCCTGGAACAGCAACAACCTGGACTCCAAAGTCGACGGCAACTACAATTACCTGTACCGGCTGTTCctgacttctgatcaacctcgCTACATACCTCGCTCTGCTAATCCTGTTACCAGTAGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTAGACTCAAGACGATAGTTACCGGATAAGGCGCtttccgtcccacctggtttaAGATGGCCTACCGGTTCAACGGCATCGGAGTGACACAGAATGTGCTGTACGAGAACCAGAAGCTGATCGCCAACCAGTTCAACAACGCCATCGGCAAGATCCAGGACAGCCTGA

Here is the recipe for the PCR mix. we use Perfecta toughmix UNG from Quantabio, but probably any PCR reagent for Taqman will work.

we checked over a dozen primer pairs and did touchdown gradients to find a PCR condition that worked well for all primer pairs and gave zero background. here it is. touchdown-PCR is one of our favorite ways to make very sensitive (single molecule) but very specific PCR.

now for some results from the best primer/probe combinations.

summary. Pfizer got cleaner. as i predicted.

everyone wants to know ng/dose. this is an underestimate because i am converting copy number to ng assuming no fragmentation (which we know is not true).. most targets will in fact be cut and therefore invisible, but for now the tallest bar is a lower estimate.

yes, there was more than 10 ng / dose. i am sure of it now.

old pfizer had more than the regulatory limit of 10ng of dna per dose.

new pfizer is cleaner than old pfizer.

new moderna is twenty thousand times cleaner than old pfizer.

anything worth doing is worth overdoing.

Share this Scrolly Tale with your friends.

A Scrolly Tale is a new way to read Twitter threads with a more visually immersive experience.
Discover more beautiful Scrolly Tales like this.

Keep scrolling