I see that there is a lot of chat about ancestry and indigeneity, two complex and profoundly misunderstood concepts. Here’s a thread 1/N - I have written about these ideas extensively, in two books; bit.ly/3r5iLDR
Ancestry rapidly becomes a matted web rather than a tree. Claims of ancestral purity are absurd. We are descended from multitudes, and don’t bear DNA from actual ancestors after very few generations. (fig. from @Graham_Coop
With both ancestry and indigeneity, the pertinent question is ‘when?’ If you claim ancestry from a certain group of people, then you are timestamping when you consider these ancestors to be important (to you). 3/N
Similarly, with claims of indigeneity, there is no agreed time when this kicks in.
There are a few places that have been populated by human in recent history, and so logical claims of an indigenous people make more sense, e.g. the Māori of New Zealand were the first humans to live on Aotearoa from the 12th C.
Male Danish and Norwegian Vikings + female Scots/Faroese/Irish women were the first to live permanently on Iceland (there is some evidence that there might’ve been a monk or two there previously, but they left no descendants, on account of them being monks). 6/N
The origins of what we sometimes now call First Nations or Indigenous people of the Americas was the arrival of people across the Bering land mass around 20k years ago, and were isolated in the Americas until Columbus invaded. 7/N
Now, I get a lot of traffic from people (often with middle ages or Anglo Saxon sounding pseudonyms) claiming various things about British indigeneity, but I remain bigly unconvinced, because of this issue of arbitrary timestamps. When do you mean? 8/N
The lands that are now Britain have been occupied by humans for around 900,000 years (the earliest evidence from Happisburgh in Norfolk. But these footprints do not betray what species these people were – it’s certainly earlier than Homo sapiens. 9/N Happisburgh footprints
But we have been invaded, colonised, enjoyed and endured occupation throughout our entire history. The legacies of that can be seen in the finest whispers in our DNA. 10/N
These lands have been occupied fairly continuously for almost a million years, by humans of countless lineages, rendering the concept of indigeneity effectively meaningless.
And yes, Stewart Lee does this brilliantly in his ‘coming over here…’ routine.
bit.ly/2KdeVrR
In many cases, though not all, the claims of British indigeneity are apparently a shallow cover for recent, post-colonial immigration. There’s not much I can say about that view, other than attempting to back it up with historical, ancestral or indigenous claims is folly. 12/N
Claims of for e.g. Celtic ancestry can be muddled, as Celt is more a cultural grouping than a genetic or genealogical one. Celtic means different things to different people, historical Celtic cultures are not necessarily genealogically related (@theAliceRoberts is great on this).
Which brings me to the Great Replacement. This is a conspiracy theory formally described in 2010 by a French writer. It asserts that a global elite is conspiring to replace white Europeans with non Europeans. 14/N
It is, of course, drawn from much older, and predominantly Nazi propaganda, and more recently Enoch Powell’s Rivers of Blood, and the neo-Nazi David Lane’s White Genocide Manifesto; spree killers cite it sometimes. 15/N
As such, the idea of the Great Replacement is riven with antisemitic coded language e.g. ‘global elites’. They are unequivocally paranoid racist conspiracy theories, i.e. not evidence based. And should be regarded as such. That it is entering the mainstream is troubling. 16/N
Its ancestry also included popular eugenics ideas of the early 20th C, such as 'White Suicide'. This features an eternal trope in population control and migration angst, which is the ‘right people’ aren’t having enough babies, and the ‘wrong people’ are having too many. 17/N
Key scientific and political eugenics proponents felt strongly that this was *the* problem: Galton, RA Fisher, Churchill, FDR, and many more expressed profound concern about this essentially Malthusian idea. Invariably, it is a smokescreen for hegemonic power. 18/N
There was in fact a great replacement of the British people, but it happened about 6000 years ago, and has no bearing on the current paranoid racist fantasies. Fascinating paper here by @Boothicus @mt_genes et al.
go.nature.com/2WkuArL
Anyway, I’ve run out of steam. Ancestry is complex and poorly understood. Indigeneity is similarly complex and requires nuance and thought. Admixture is the norm, migration is continuous, and no people is pure. 20/N
Anyone who tells you otherwise is selling something.

Science is no ally when claiming ownership of lands, nor separation or superiority of races. These are the facts of biology.

21/21
Apparently I'm a Marxist now, Father.
This tweet is a great example: This guy says 1000 years is the threshold, so presumably would think that America should only be for Nature Americans?

Native, obvs, goddamit. Stupid autofellatio

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Dr Adam Rutherford

Dr Adam Rutherford Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @AdamRutherford

13 Dec
Oh heavens. Briefly, the D in PhD, DPhil, EdD (et al) stands for Doctor, this qualification is a doctorate. It comes from the Latin docere - to teach. 1/n
It predates the use of doctor by medical practitioners, but society has agreed by consensus to refer to physicians as doctor, regardless of whether they have doctorates. This is fine and invoking an etymological origin doesn’t help. Dr Jill Biden is a doctor. 2/n
Oh yes it’s hilarious to say that someone who has a PhD in history can’t deliver a baby, but only if you’re a drooling gurgleturd. I myself have delivered 3 babies and also have a PhD, not in delivering babies but in developmental genetics. 3/n
Read 9 tweets
30 Nov
The @DeepMind protein folding result is really incredible, and incredibly important. But I know it’s pretty tricky to understand, so here’s a megathread, with a bit of Biology 101, for @holland_tom @thehistoryguy
et al.

bit.ly/2JnKQoF
@DeepMind @holland_tom @thehistoryguy Here we go: Genes are long strings of molecules made up of an alphabet of four ‘letters’

e.g.

gacgaagagcccatgatcaacgac
@DeepMind @holland_tom @thehistoryguy Each triplet of letters encodes an amino acid (which we code as capital letters)

gac gaa gag ccc atg atc aac gac

translates to

D. E. E. P. M. I. N. D.
Read 16 tweets
15 Nov
I'm seeing a lot of chat about PCR and COVID, some of it quite bonkers. So here’s a PCR 101.

DNA is very small and therefore not easy to detect. PCR is a tool for multiplying specific bits of DNA from a few to billions, thus making it easy to detect. 1/n
PCR is a standard tool in molecular biology, and has been for decades. It was, by the way, invented by Kary Mullis, who claims to have come up with the idea whilst tripping balls on LSD. Mullis was a bit of a jerk btw, an AIDS and Climate Change denialist. 2/n Kary Mullis, who was a bit of a jerk
Right, so DNA is a DOUBLE helix, meaning it has two strands made up of chains of just 4 ‘letters’ that pair up in a specific way (that is, ‘complementary’): A pairs with T, C pairs with G. a bit like this.

GAACTTAATTAA
CTTGAATTAATT

3/n
Read 17 tweets
21 Oct
James Randi RIP, the Great Randi.

My quick James Randi story. I only met him once, and he told me this tale, which you could stop at almost any point and it would still be an amazing story. He said… 1/n James Randi
‘When I was on Happy Days, the Fonz and I were going to have lunch with Richie Cunningham…’

I mean, it’s a good opener.
We went to a Mexican restaurant, that was set back from the street by a long dark corridor, the only light for which came from the street door. As we were in this tunnel, suddenly, the light is blocked and we are in pitch black. 3/n
Read 5 tweets
21 Oct
I wonder where they stand on social constructionism. In fact, I demand to know this governments views on meta-ethical relativism. I DEMAND IT.
In fact, I think the Government should take a stand on all manner of academic disputes and topics. Group selection? WHO IS THE MINISTER FOR ANTS.
Abiogenesis: WILL THE RIGHT HONOURABLE MEMBER CLARIFY IF SHE SUPPORTS THE RNA WORLD HYPOTHESIS DESPITE THE FACT THAT THERMODYNAMIC EQUILIBRIUM VIA PROTON GRADIENTS IS A BETTER EXPLANATION FOR THE TRANSITION FROM GEOCHEMISTRY TO BIOCHEMISTRY IN THE HADEAN?
Read 5 tweets
20 Oct
Ok, a quick thread on white supremacy symbols - I spend a lot of time on white supremacy forums online, and they have dozens of really idiotic numerical codes, most of which are substitution ciphers that a 7 year old would come up with.
Darren appears to have these two on his face
88 = HH = Heil Hitler
23/16 = WP = White Supremacy

There's also:
18 = AH = Adolf Hitler
1488: a reference to the so-called 14 words, coined by white supremacist terrorist David Lane
There's also:
1/11 = AK = Aryan Knights
3/11 = 3 K = KKK
109 = the claim that Jews have been expelled from 109 nations throughout history, sometimes coupled with
110 = in the hope that the US will be the next one
Read 8 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Too expensive? Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal Become our Patreon

Thank you for your support!

Follow Us on Twitter!