Kevin McKernan Profile picture
Jan 9, 2021 19 tweets 8 min read Read on X
🙏🏼 for the follows.
My goal is to simply share what I know about genomics with the public when it matters most.

I rarely get technical refutations but embrace the errors so as to correct.

The best they seem to be able to fire back is ad hominens and associative fallacies
From 1996 to 2000 I worked tirelessly to get as much as human genome public as possible.

Our team then built a DNA sequencer that dropped the price of DNA sequencer several orders of magnitude.

Published open access.

genome.cshlp.org/content/19/9/1…Image
In 2000 we started a genomic company called Agencourt.
It became the largest commercial seq shop at the time.
Turned profitable in 18 months from start-up.

We also built DNA and RNA purification kits for viruses using SPRI

Some of these kits are in use today for C19 prep. Image
We also became one of 5 NHGRI genome centers along with MIT, Baylor, WashU, and Venter.

We built it in the burbs. Had low overhead and focused on plasmid whole genome shotgun and Fosmids.

Our niche play made us the cheapest center for these protocols. Image
Beckman Coulter acquired the 120 person company and spun out Agencourt Personal Genomics which build the SOLiD sequencer and was acquired a year later as a 19 person start-up.

SOLIiD was based on a several revolutionary ideas.

Emulation PCR from JHU

Image
Image
This enabled billions of individual 30um diameter PCR reactions to be performed in a single reaction vessel.

We’d put a 1um magnetic bead in each bubble that had one of the 2 PCR primers on it and we could get DNA to amplify to the bead and coat it like a tennis ball w/DNA. Image
Now, if you put a low concentration of library of 🧬 that had sequence that matched the Bead primer and a second solution primer you could amplify a single molecule to bead and make 100,000 copies of the DNA on the magnetic particle.

Now each bead could be sequenced. Image
I bring this up because it made our team understand PCR at a single molecule level and at a depth no one had ever seen before.

We needed a deep understanding of Oligo synthesis and artifacts that impacted massively parallel single molecule sensitive PCR at scales never seen b4. Image
This company was Acquired by Applied Biosystems which was then acquired by Life Tech and then Thermo.

Thermo is one the largest picks and shovels companies in PCR testing.

But it was time to give back.

We were sequencing cancer biopsies now...
We could now sequence human genomes for under $5K and that meant tumor sequencing could help personalize cancer therapy.

More work with JHU and SOLiD decorated the cover of Science T Med.

stm.sciencemag.org/content/2/20/2…Image
We could personalize but the drug choices were splitting hairs on poison.

Cannabinoids caught my attention.

It’s genome wasnt sequenced yet.

July 2011- flew to Amsterdam.

Purified DNA in a hotel room.

Sequence assembly public Aug 18. Image
Image
Fast Company picked up on it.

fastcompany.com/1774755/sequen…Image
At this turn in my career, I started to wise up to the scientific censorship and ridicule of certain fields of study.

I became an open source vigilante and became enthralled with censorship resistant Blockchains.

Published some clinical PCR methods to weaken gene patents. Image
We began thinking about how distributed consensus protocols could enhance scientific funding and transparency in Peer Review.

Ran another Cannabis genome project this way.

60 days from funding to public upload.

The THC/CBD+ Jamaican Lion genome.

We decided to crack the stigma on the field and organized the CannMed conference at Harvard Medical School.
@CannMedEvents

Videos cover diverse topics from Cancer, Plant pathogens, tissue culture, FDA trials, extraction chemistry and genomics.

Public
cannmedevents.com/cannmed-video-…
We have recently sequenced and put public Kratom and Psilocybe cubensis (magic mushrooms) as these genomes make natural break through therapies and we need these genomes in the public domain.

Public Psilocybe Cubensis Genome browser.
Why am I an open source zealot?

I realize innovation is a team sport and it’s rare all the team member are in your location.

Public data floats all boats. It accelerates innovation providing more opportunity to nimble and energetic curiosity.

Data in one mind is a waste.
This also means I’ve become impatient with centralized and slow peer review as its prone to censorship and poor quality.
Performed anon and with conflicts ....and this how we seed fake news.
I think I’ve earned the public’s trust on being able to view in on the peer review of a PCR protocol that is currently choking the world.

Yet the wing of science communicators and merchants of despair can’t defend these critiques.

They slander.

Who do you believe?

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Kevin McKernan

Kevin McKernan Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @Kevin_McKernan

Feb 7
The latest BS on @biorxivpreprint Image
This paper tries to makes claims of RT-qPCR sensitivity with a LLOQ of 372,800 molecules/ml as their lowest limit of Quantiation.

As a comparison, most clinical HIV RT-qPCR tests pick up 50 molecules/ml.
Hence they have very optimistic clearance rates.
biorxiv.org/content/10.648…
0.00085ng/ml is 372,800 copies. Image
Read 7 tweets
Jan 31
It is well known from BioNtech (Lenk et al) and Sutton et al (1997) that RNA:DNA hybrids inhibit DNaseI.

What is less known is that Quadruplex Gs also inhibit DNaseI. Some exist in SV40 and we get the most signal from this qPCR amplicon.

2 Different mechanisms of DNaseI inhibition = plasmid fragmentation cannot be assumed to be uniform in the mRNA vaccines. Hence 100 fold more spike than parts of the vector.

Below is a map of the codon optimized spike where Quadruplex Gs are overlaid with GAA repeats. GAA's are stickier RNA:DNA hybrids.

Our qPCR primers are overlayed as well.
@RetsefL @KUPERWASSERLAB @weldeiry @JesslovesMJK @DJSpeicher @TracyBethHoeg @DrJBhattacharyaImage
Evans et al demonstrate DNaseI is resistant to quadruplex Gs. They also move to alternative enzymes.
nature.com/articles/s4152…
This is from Lenk et al (BioNtech).
Note the concern over GAA sequences and RNA:DNA hybrids.
Our spike qPCR primers happen to land on GAA rich and quadruplex G rich regions of Spike.
frontiersin.org/journals/molec…Image
Read 4 tweets
Jan 30
@LocasaleLab I find the RNAi worship incongruent will how that entire field was ignored when injecting billions of people with mRNAs.
There are multiple 21bp homologies to human that emerged from the haphazard codon optimizations in the modRNA vaccine and no one cared?
@LocasaleLab Receipts.
Take Pfizers vax Sequence and run it through BLAT.
Hello... anyone from the RNAi space want to speak up about this? Image
ATGTTCGTGTTCCTGGTGCTGCTGCCTCTGGTGTCCAGCCAGTGTGTGAACCTGATCACCAGAACACAGTCATACACCAACAGCTTTACCAGAGGCGTGTACTACCCCGACAAGGTGTTCAGATCCAGCGTGCTGCACTCTACCCAGGACCTGTTCCTGCCTTTCTTCAGCAACGTGACCTGGTTCCACGCCATCTCCGGCACCAATGGCACCAAGAGATTCGACAACCCCGTGCTGCCCTTCAACGACGGGGTGTACTTTGCCAGCACCGAGAAGTCCAACATCATCAGAGGCTGGATCTTCGGCACCACACTGGACAGCAAGACCCAGAGCCTGCTGATCGTGAACAACGCCACCAACGTGGTCATCAAAGTGTGCGAGTTCCAGTTCTGCAACGACCCCTTCCTGGACGTCTACTACCACAAGAACAACAAGAGCTGGATGGAAAGCGAGTTCCGGGTGTACAGCAGCGCCAACAACTGCACCTTCGAGTACGTGTCCCAGCCTTTCCTGATGGACCTGGAAGGCAAGCAGGGCAACTTCAAGAACCTGCGCGAGTTCGTGTTTAAGAACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCTATCAACCTCGGCCGGGATCTGCCTCAGGGCTTCTCTGCTCTGGAACCCCTGGTGGATCTGCCCATCGGCATCAACATCACCCGGTTTCAGACACTGCTGGCCCTGCACAGAAGCTACCTGACACCTGGCGATAGCAGCAGCGGATGGACAGCTGGTGCCGCCGCTTACTATGTGGGCTACCTGCAGCCTAGAACCTTCCTGCTGAAGTACAACGAGAACGGCACCATCACCGACGCCGTGGATTGTGCTCTGGATCCTCTGAGCGAGACAAAGTGCACCCTGAAGTCCTTCACCGTGGAAAAGGGCATCTACCAGACCAGCAACTTCCGGGTGCAGCCCACCGAATCCATCGTGCGGTTCCCCAATATCACCAATCTGTGCCCCTTCGACGAGGTGTTCAATGCCACCAGATTCGCCTCTGTGTACGCCTGGAACCGGAAGCGGATCAGCAATTGCGTGGCCGACTACTCCGTGCTGTACAACTTCGCCCCCTTCTTCGCATTCAAGTGCTACGGCGTGTCCCCTACCAAGCTGAACGACCTGTGCTTCACAAACGTGTACGCCGACAGCTTCGTGATCCGGGGAAACGAAGTGCGGCAGATTGCCCCTGGACAGACAGGCAACATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGTGTGATTGCCTGGAACAGCAACAAGCTGGACTCCAAAGTCGGCGGCAACTACAATTACAGGTACCGGCTGTTCCGGAAGTCCAATCTGAAGCCCTTCGAGCGGGACATCTCCACCGAGATCTATCAGGCCGGCAACAAGCCTTGTAACGGCGTGGCAGGCGTGAACTGCTACTTCCCACTGCAGTCCTACGGCTTTAGGCCCACATACGGCGTGGGCCACCAGCCCTACAGAGTGGTGGTGCTGAGCTTCGAACTGCTGCATGCCCCTGCCACAGTGTGCGGCCCTAAGAAAAGCACCAATCTCGTGAAGAACAAATGCGTGAACTTCAACTTCAACGGCCTGACCGGCACCGGCGTGCTGACAGAGAGCAACAAGAAGTTCCTGCCATTCCAGCAGTTTGGCCGGGATATCGCCGATACCACAGACGCCGTTAGAGATCCCCAGACACTGGAAATCCTGGACATCACCCCTTGCAGCTTCGGCGGAGTGTCTGTGATCACCCCTGGCACCAACACCAGCAATCAGGTGGCAGTGCTGTACCAGGGCGTGAACTGTACCGAAGTGCCCGTGGCCATTCACGCCGATCAGCTGACACCTACATGGCGGGTGTACTCCACCGGCAGCAATGTGTTTCAGACCAGAGCCGGCTGTCTGATCGGAGCCGAGTACGTGAACAATAGCTACGAGTGCGACATCCCCATCGGCGCTGGAATCTGCGCCAGCTACCAGACACAGACAAAGAGCCACCGGAGAGCCAGAAGCGTGGCCAGCCAGAGCATCATTGCCTACACAATGTCTCTGGGCGCCGAGAACAGCGTGGCCTACTCCAACAACTCTATCGCTATCCCCACCAACTTCACCATCAGCGTGACCACAGAGATCCTGCCTGTGTCCATGACCAAGACCAGCGTGGACTGCACCATGTACATCTGCGGCGATTCCACCGAGTGCTCCAACCTGCTGCTGCAGTACGGCAGCTTCTGCACCCAGCTGAAAAGAGCCCTGACAGGGATCGCCGTGGAACAGGACAAGAACACCCAAGAGGTGTTCGCCCAAGTGAAGCAGATCTACAAGACCCCTCCTATCAAGTACTTCGGCGGCTTCAATTTCAGCCAGATTCTGCCCGATCCTAGCAAGCCCAGCAAGCGGAGCTTCATCGAGGACCTGCTGTTCAACAAAGTGACACTGGCCGACGCCGGCTTCATCAAGCAGTATGGCGATTGTCTGGGCGACATTGCCGCCAGGGATCTGATTTGCGCCCAGAAGTTTAACGGACTGACAGTGCTGCCTCCTCTGCTGACCGATGAGATGATCGCCCAGTACACATCTGCCCTGCTGGCCGGCACAATCACAAGCGGCTGGACATTTGGAGCAGGCGCCGCTCTGCAGATCCCCTTTGCTATGCAGATGGCCTACCGGTTCAACGGCATCGGAGTGACCCAGAATGTGCTGTACGAGAACCAGAAGCTGATCGCCAACCAGTTCAACAGCGCCATCGGCAAGATCCAGGACAGCCTGAGCAGCACAGCAAGCGCCCTGGGAAAGCTGCAGGACGTGGTCAACCACAATGCCCAGGCACTGAACACCCTGGTCAAGCAGCTGTCCTCCAAGTTCGGCGCCATCAGCTCTGTGCTGAACGATATCCTGAGCAGACTGGACCCTCCTGAGGCCGAGGTGCAGATCGACAGACTGATCACAGGCAGACTGCAGAGCCTCCAGACATACGTGACCCAGCAGCTGATCAGAGCCGCCGAGATTAGAGCCTCTGCCAATCTGGCCGCCACCAAGATGTCTGAGTGTGTGCTGGGCCAGAGCAAGAGAGTGGACTTTTGCGGCAAGGGCTACCACCTGATGAGCTTCCCTCAGTCTGCCCCTCACGGCGTGGTGTTTCTGCACGTGACATATGTGCCCGCTCAAGAGAAGAATTTCACCACCGCTCCAGCCATCTGCCACGACGGCAAAGCCCACTTTCCTAGAGAAGGCGTGTTCGTGTCCAACGGCACCCATTGGTTCGTGACACAGCGGAACTTCTACGAGCCCCAGATCATCACCACCGACAACACCTTCGTGTCTGGCAACTGCGACGTCGTGATCGGCATTGTGAACAATACCGTGTACGACCCTCTGCAGCCCGAGCTGGACAGCTTCAAAGAGGAACTGGACAAGTACTTTAAGAACCACACAAGCCCCGACGTGGACCTGGGCGATATCAGCGGAATCAATGCCAGCGTCGTGAACATCCAGAAAGAGATCGACCGGCTGAACGAGGTGGCCAAGAATCTGAACGAGAGCCTGATCGACCTGCAAGAACTGGGGAAGTACGAGCAGTACATCAAGTGGCCCTGGTACATCTGGCTGGGCTTTATCGCCGGACTGATTGCCATCGTGATGGTCACAATCATGCTGTGTTGCATGACCAGCTGCTGTAGCTGCCTGAAGGGCTGTTGTAGCTGTGGCAGCTGCTGCAAGTTCGACGAGGACGATTCTGAGCCCGTGCTGAAGGGCGTGAAACTGCACTACACATGATGA
Read 8 tweets
Jan 19
On Veterans Day @CharlesRixey @JesslovesMJK
Stopped by MGC.

2 long days later we had all of his data.

It’s now published in The Journal of Independent Medicine.

It describes the mechanism of failure for the DNA contamination in the mRNA shots and why the regulators are missing it.
@JesslovesMJK @CharlesRixey @weldeiry @KUPERWASSERLAB @RetsefL @DrJBhattacharya @RWMaloneMD @RobertKennedyJr @TracyBethHoegImage
Image
Image
Image
Image
Read 5 tweets
Dec 19, 2025
Another Achs et al Fumble uncovered.
These folks don't even understand Capillary Electrophoresis.

Its becoming increasingly clear these are not honest mistakes but designed to deceive by people who are employed at a Vaccine Research Institute.
Science for Sale.

@JesslovesMJK @DJSpeicherImage
Here is the Rub.
They used a CE instrument that has a lower limit of sensitivity above the 10ng limit.
You need to be able to pick up 10X below the 10ng limit. Or 33pg/ul (300ul dose @ 10ng = 33pg/ul) Image
This is embarrassingly rigged or they are incompetent.
They ignored our comments on the preprint server and raced their paper into @Nature.

@JesslovesMJK and @DJSpeicher have their own substacks picking up other errors in this paper I'll post sortly. Image
Read 5 tweets
Dec 15, 2025
Image
Image
Note, its unique to that wonderful Furin Cleavage site. Image
Read 4 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Don't want to be a Premium member but still want to support us?

Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal

Or Donate anonymously using crypto!

Ethereum

0xfe58350B80634f60Fa6Dc149a72b4DFbc17D341E copy

Bitcoin

3ATGMxNzCUFzxpMCHL5sWSt4DVtS8UqXpi copy

Thank you for your support!

Follow Us!

:(