Kevin McKernan Profile picture
Aug 7, 2021 13 tweets 4 min read Read on X
Anyone want to guess what’s wrong with this paper?

It’s making the rounds as some reason to wear masks. academic.oup.com/cid/advance-ar…
Here is one hint.
They target the N gene which is the highest copy subgenomic RNA in the genome.
SgRNA isn’t infectious.

N numbers are tiny.
KIm et al demonstrate how much higher expression you can have of non-infectious N gene.
Orders of magnitude.
This is pure Merchants of Mask Malaise.
Fear porn, spun with a veil of credibility and timed for school.
There are methods to perform viability PCR on SARs-CoV-2.

I wonder why the authors didn’t pursue those?

epa.gov/healthresearch…
Here is another way to sort out infectious Vs non-infectious virus.

medrxiv.org/content/10.110…
Just to clarify.
This is the Nanopore coverage Map.
Lowest point in the trough in the center looks like 2,000X coverage.
Highest point on the right is ~500,000X coverage.
Obviously full length infective virus can’t be more than the 2,000X and the stuff on the right is non-infect
Non-infectious fragments of RNA known as sub genomic RNA or sgRNA.

Why would you place your PCR assay on the yellow region? You know you are predominately amplifying non-infectious RNA.

Deliberate witch hunting.
Should could target ORF1a (in the trough of the coverage map) that makes less subgenomic RNA but her sensitivity would drop ~200 fold.

But she’s only working with 6-5,800 copies.
Most of the data would be blank.
They’d have to speak for hours...
Into a vacuum tube.
Redonkulus
Interesting detail.
They did not Try to culture the coarse fraction (Over 5um).

That would have been very valuable information.

The diagnostic PCR does have low Ct but that’s PCR with diff assay/ diff lab/ diff time.

130L/min vacuum for 15-30 minutes.
Really shouldn’t say there is anything wrong with the paper....just seeing people use this as evidence for masking kids and it does not follow.

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Kevin McKernan

Kevin McKernan Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @Kevin_McKernan

May 19
This never happens..
Except when it does.
First time- Really?
nejm.org/doi/full/10.10…
10% get cancer..
Thats must be what they meant by "rare" Image
Read 6 tweets
Feb 7
The latest BS on @biorxivpreprint Image
This paper tries to makes claims of RT-qPCR sensitivity with a LLOQ of 372,800 molecules/ml as their lowest limit of Quantiation.

As a comparison, most clinical HIV RT-qPCR tests pick up 50 molecules/ml.
Hence they have very optimistic clearance rates.
biorxiv.org/content/10.648…
0.00085ng/ml is 372,800 copies. Image
Read 7 tweets
Jan 31
It is well known from BioNtech (Lenk et al) and Sutton et al (1997) that RNA:DNA hybrids inhibit DNaseI.

What is less known is that Quadruplex Gs also inhibit DNaseI. Some exist in SV40 and we get the most signal from this qPCR amplicon.

2 Different mechanisms of DNaseI inhibition = plasmid fragmentation cannot be assumed to be uniform in the mRNA vaccines. Hence 100 fold more spike than parts of the vector.

Below is a map of the codon optimized spike where Quadruplex Gs are overlaid with GAA repeats. GAA's are stickier RNA:DNA hybrids.

Our qPCR primers are overlayed as well.
@RetsefL @KUPERWASSERLAB @weldeiry @JesslovesMJK @DJSpeicher @TracyBethHoeg @DrJBhattacharyaImage
Evans et al demonstrate DNaseI is resistant to quadruplex Gs. They also move to alternative enzymes.
nature.com/articles/s4152…
This is from Lenk et al (BioNtech).
Note the concern over GAA sequences and RNA:DNA hybrids.
Our spike qPCR primers happen to land on GAA rich and quadruplex G rich regions of Spike.
frontiersin.org/journals/molec…Image
Read 4 tweets
Jan 30
@LocasaleLab I find the RNAi worship incongruent will how that entire field was ignored when injecting billions of people with mRNAs.
There are multiple 21bp homologies to human that emerged from the haphazard codon optimizations in the modRNA vaccine and no one cared?
@LocasaleLab Receipts.
Take Pfizers vax Sequence and run it through BLAT.
Hello... anyone from the RNAi space want to speak up about this? Image
ATGTTCGTGTTCCTGGTGCTGCTGCCTCTGGTGTCCAGCCAGTGTGTGAACCTGATCACCAGAACACAGTCATACACCAACAGCTTTACCAGAGGCGTGTACTACCCCGACAAGGTGTTCAGATCCAGCGTGCTGCACTCTACCCAGGACCTGTTCCTGCCTTTCTTCAGCAACGTGACCTGGTTCCACGCCATCTCCGGCACCAATGGCACCAAGAGATTCGACAACCCCGTGCTGCCCTTCAACGACGGGGTGTACTTTGCCAGCACCGAGAAGTCCAACATCATCAGAGGCTGGATCTTCGGCACCACACTGGACAGCAAGACCCAGAGCCTGCTGATCGTGAACAACGCCACCAACGTGGTCATCAAAGTGTGCGAGTTCCAGTTCTGCAACGACCCCTTCCTGGACGTCTACTACCACAAGAACAACAAGAGCTGGATGGAAAGCGAGTTCCGGGTGTACAGCAGCGCCAACAACTGCACCTTCGAGTACGTGTCCCAGCCTTTCCTGATGGACCTGGAAGGCAAGCAGGGCAACTTCAAGAACCTGCGCGAGTTCGTGTTTAAGAACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCTATCAACCTCGGCCGGGATCTGCCTCAGGGCTTCTCTGCTCTGGAACCCCTGGTGGATCTGCCCATCGGCATCAACATCACCCGGTTTCAGACACTGCTGGCCCTGCACAGAAGCTACCTGACACCTGGCGATAGCAGCAGCGGATGGACAGCTGGTGCCGCCGCTTACTATGTGGGCTACCTGCAGCCTAGAACCTTCCTGCTGAAGTACAACGAGAACGGCACCATCACCGACGCCGTGGATTGTGCTCTGGATCCTCTGAGCGAGACAAAGTGCACCCTGAAGTCCTTCACCGTGGAAAAGGGCATCTACCAGACCAGCAACTTCCGGGTGCAGCCCACCGAATCCATCGTGCGGTTCCCCAATATCACCAATCTGTGCCCCTTCGACGAGGTGTTCAATGCCACCAGATTCGCCTCTGTGTACGCCTGGAACCGGAAGCGGATCAGCAATTGCGTGGCCGACTACTCCGTGCTGTACAACTTCGCCCCCTTCTTCGCATTCAAGTGCTACGGCGTGTCCCCTACCAAGCTGAACGACCTGTGCTTCACAAACGTGTACGCCGACAGCTTCGTGATCCGGGGAAACGAAGTGCGGCAGATTGCCCCTGGACAGACAGGCAACATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGTGTGATTGCCTGGAACAGCAACAAGCTGGACTCCAAAGTCGGCGGCAACTACAATTACAGGTACCGGCTGTTCCGGAAGTCCAATCTGAAGCCCTTCGAGCGGGACATCTCCACCGAGATCTATCAGGCCGGCAACAAGCCTTGTAACGGCGTGGCAGGCGTGAACTGCTACTTCCCACTGCAGTCCTACGGCTTTAGGCCCACATACGGCGTGGGCCACCAGCCCTACAGAGTGGTGGTGCTGAGCTTCGAACTGCTGCATGCCCCTGCCACAGTGTGCGGCCCTAAGAAAAGCACCAATCTCGTGAAGAACAAATGCGTGAACTTCAACTTCAACGGCCTGACCGGCACCGGCGTGCTGACAGAGAGCAACAAGAAGTTCCTGCCATTCCAGCAGTTTGGCCGGGATATCGCCGATACCACAGACGCCGTTAGAGATCCCCAGACACTGGAAATCCTGGACATCACCCCTTGCAGCTTCGGCGGAGTGTCTGTGATCACCCCTGGCACCAACACCAGCAATCAGGTGGCAGTGCTGTACCAGGGCGTGAACTGTACCGAAGTGCCCGTGGCCATTCACGCCGATCAGCTGACACCTACATGGCGGGTGTACTCCACCGGCAGCAATGTGTTTCAGACCAGAGCCGGCTGTCTGATCGGAGCCGAGTACGTGAACAATAGCTACGAGTGCGACATCCCCATCGGCGCTGGAATCTGCGCCAGCTACCAGACACAGACAAAGAGCCACCGGAGAGCCAGAAGCGTGGCCAGCCAGAGCATCATTGCCTACACAATGTCTCTGGGCGCCGAGAACAGCGTGGCCTACTCCAACAACTCTATCGCTATCCCCACCAACTTCACCATCAGCGTGACCACAGAGATCCTGCCTGTGTCCATGACCAAGACCAGCGTGGACTGCACCATGTACATCTGCGGCGATTCCACCGAGTGCTCCAACCTGCTGCTGCAGTACGGCAGCTTCTGCACCCAGCTGAAAAGAGCCCTGACAGGGATCGCCGTGGAACAGGACAAGAACACCCAAGAGGTGTTCGCCCAAGTGAAGCAGATCTACAAGACCCCTCCTATCAAGTACTTCGGCGGCTTCAATTTCAGCCAGATTCTGCCCGATCCTAGCAAGCCCAGCAAGCGGAGCTTCATCGAGGACCTGCTGTTCAACAAAGTGACACTGGCCGACGCCGGCTTCATCAAGCAGTATGGCGATTGTCTGGGCGACATTGCCGCCAGGGATCTGATTTGCGCCCAGAAGTTTAACGGACTGACAGTGCTGCCTCCTCTGCTGACCGATGAGATGATCGCCCAGTACACATCTGCCCTGCTGGCCGGCACAATCACAAGCGGCTGGACATTTGGAGCAGGCGCCGCTCTGCAGATCCCCTTTGCTATGCAGATGGCCTACCGGTTCAACGGCATCGGAGTGACCCAGAATGTGCTGTACGAGAACCAGAAGCTGATCGCCAACCAGTTCAACAGCGCCATCGGCAAGATCCAGGACAGCCTGAGCAGCACAGCAAGCGCCCTGGGAAAGCTGCAGGACGTGGTCAACCACAATGCCCAGGCACTGAACACCCTGGTCAAGCAGCTGTCCTCCAAGTTCGGCGCCATCAGCTCTGTGCTGAACGATATCCTGAGCAGACTGGACCCTCCTGAGGCCGAGGTGCAGATCGACAGACTGATCACAGGCAGACTGCAGAGCCTCCAGACATACGTGACCCAGCAGCTGATCAGAGCCGCCGAGATTAGAGCCTCTGCCAATCTGGCCGCCACCAAGATGTCTGAGTGTGTGCTGGGCCAGAGCAAGAGAGTGGACTTTTGCGGCAAGGGCTACCACCTGATGAGCTTCCCTCAGTCTGCCCCTCACGGCGTGGTGTTTCTGCACGTGACATATGTGCCCGCTCAAGAGAAGAATTTCACCACCGCTCCAGCCATCTGCCACGACGGCAAAGCCCACTTTCCTAGAGAAGGCGTGTTCGTGTCCAACGGCACCCATTGGTTCGTGACACAGCGGAACTTCTACGAGCCCCAGATCATCACCACCGACAACACCTTCGTGTCTGGCAACTGCGACGTCGTGATCGGCATTGTGAACAATACCGTGTACGACCCTCTGCAGCCCGAGCTGGACAGCTTCAAAGAGGAACTGGACAAGTACTTTAAGAACCACACAAGCCCCGACGTGGACCTGGGCGATATCAGCGGAATCAATGCCAGCGTCGTGAACATCCAGAAAGAGATCGACCGGCTGAACGAGGTGGCCAAGAATCTGAACGAGAGCCTGATCGACCTGCAAGAACTGGGGAAGTACGAGCAGTACATCAAGTGGCCCTGGTACATCTGGCTGGGCTTTATCGCCGGACTGATTGCCATCGTGATGGTCACAATCATGCTGTGTTGCATGACCAGCTGCTGTAGCTGCCTGAAGGGCTGTTGTAGCTGTGGCAGCTGCTGCAAGTTCGACGAGGACGATTCTGAGCCCGTGCTGAAGGGCGTGAAACTGCACTACACATGATGA
Read 8 tweets
Jan 19
On Veterans Day @CharlesRixey @JesslovesMJK
Stopped by MGC.

2 long days later we had all of his data.

It’s now published in The Journal of Independent Medicine.

It describes the mechanism of failure for the DNA contamination in the mRNA shots and why the regulators are missing it.
@JesslovesMJK @CharlesRixey @weldeiry @KUPERWASSERLAB @RetsefL @DrJBhattacharya @RWMaloneMD @RobertKennedyJr @TracyBethHoegImage
Image
Image
Image
Image
Read 5 tweets
Dec 19, 2025
Another Achs et al Fumble uncovered.
These folks don't even understand Capillary Electrophoresis.

Its becoming increasingly clear these are not honest mistakes but designed to deceive by people who are employed at a Vaccine Research Institute.
Science for Sale.

@JesslovesMJK @DJSpeicherImage
Here is the Rub.
They used a CE instrument that has a lower limit of sensitivity above the 10ng limit.
You need to be able to pick up 10X below the 10ng limit. Or 33pg/ul (300ul dose @ 10ng = 33pg/ul) Image
This is embarrassingly rigged or they are incompetent.
They ignored our comments on the preprint server and raced their paper into @Nature.

@JesslovesMJK and @DJSpeicher have their own substacks picking up other errors in this paper I'll post sortly. Image
Read 5 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Don't want to be a Premium member but still want to support us?

Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal

Or Donate anonymously using crypto!

Ethereum

0xfe58350B80634f60Fa6Dc149a72b4DFbc17D341E copy

Bitcoin

3ATGMxNzCUFzxpMCHL5sWSt4DVtS8UqXpi copy

Thank you for your support!

Follow Us!

:(