Nate Silver Profile picture
Nov 30, 2021 6 tweets 2 min read Read on X
Omicrons (B.1.1.529) most recent common ancestor is AV.1. Relative to this MRCA, Omicron has 25 nonsynonymous and 1 synonymous mutation in Spike, and 13 nonsynonymous and 6 synonymous mutations in the entire rest of the genome. This is very strange & I don't understand.
I have re-done the alignments and counting up of mutations, and it's even weirder than i first said.
34 discontinuous changes (that are likely independent events). only one of them is silent. the rest change amino acid. see attached pictures. to quote @K_G_Andersen this is inconsistent with expectations from standard evolutionary theory. ImageImage
this is just bonkers. there should be a butt-tonne of other silent passenger mutations hitching a ride with nonsynonymous changes under positive selective pressure. i am not invoking a sinister lab engineering event here, just something important that i do not know.
Spike is 3819 coding nucleotides. It has 33 NS and 1 S changes. The neighboring ORF3A-E-M-ORF6-ORF7A-ORF8-N-ORF10 genes have 4000 coding nucleotides. They have eight NS and three S changes. Spike is smaller and has four times the NS changes. ImageImage
positive selection on spike should drag a bunch of synonymous changes in the neighborhood along for the ride. unless spike can evolve separately from the rest of the genome.

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Nate Silver

Nate Silver Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @NateSilver538

Nov 29, 2024
An off-the-cuff thread on Genomics of Cancer and Aging. These is an X post of ideas for people to think about... its not medical advice or a peer reviewed publication... )
Cancers are caused by mutations in genes that control cell growth.
Aging itself may be caused by accumulation of damaging mutations that eventually kill stem cells.

Cancer-causing mutations happen in normal cells in your body and convert the normal cells into tumor cells.

You are making mutations all your life because the enzymes that copy the DNA are pretty good, but not perfect and they have a big job to do each cell division (3 billion letters to copy and get right).
Mistakes happen. Most of these mistakes do nothing. Eventually they might kill the cell because of a mutation in a gene that is needed for life. But if a mistake happens in one of a small number of cancer genes, a tumor is born.

If you sequence the genome of a tumor, it is (mostly) all the same sequence, and is descended from the cell that got the last cancer causing mutation, making that cell grow faster than the surrounding cells.

The mutations that you see in a tumor are the cancer causing mutations, AND all the harmless mutations that happened before the cancer causing mutation. Its like an ancestry family tree that records all the mutations that were going on in all the different normal cells before one cell took a hit to a cancer gene. I call this molecular archeology, and you can look back in time through the molecular fossil record and see history.
Read 17 tweets
Oct 19, 2024
A PCR protocol for monitoring the purity of covid19 mRNA vaccines and their recipients.

share with whomever might find such a protocol useful.

Step 1. Order this gBLOCK synthetic positive control from IDTDNA dot COM

CTACGTGAACCATCACCCTAATCAAGTTTTTTGAGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGATTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGtccatctgaagcgagtcgctTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTACCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCAACTCAATTAGTCAGCAACCAGGTGTGttcggaagatgccagtgtgaCGTTGGCTACCCGTGATATTGCTGAAGAACTTGACGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCACAGCGCATCGCCTTCTATCGCCTTCTTGACGAGaatggacagcgtttgcttaaCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGACTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGACCTGAATGAACTGCAAGACGAGGgccccaaagccctcgtagacCTACAGCGTGAGCTATGAGAAAGCGCCACACTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACAAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGagcatttcacgcgactagccGTTTGTTTGCCGGATCAAGAGCTACCAAATCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATAACAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGtagatctcttcctactagtcCAGCTACCAGACACAGACAAACAGCCCTCGGAGAGACAGAAGCGTGGCCAGCCAGAGCATCATTGCCTACACAATGTCTCTGGGCACCGAGAACAGCGTGGCCTACTCCAACAACTCTATCGCaaaatggcattagcgattgtACATCTGGCTGGGCTTTATCGCCGGACTGATTGCCATCGTGATGATCACAATCATGCTGTGTTGCATGACCAGCTGCTGTAGCTGCCTGAAGGGCTGTTGTAGCTGTGACAGCTGCTGCAAGTTCGACGAGGACGATTacaatcgtacgaaatggaggAGCCTACACCAACAGCTTTACCAGAGGCATGTACTACCCCGACAAGGTGTTCAGATCCAGCGTGCTGCACTATACCCAGGACCTGTTCCTGCCTTTCTTCAgcactctaatgcaaatgcagGATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACAGGCTGTGTGATTGCCTGGAACAGCAACAACCTGGACTCCAAAGTCGACGGCAACTACAATTACCTGTACCGGCTGTTCctgacttctgatcaacctcgCTACATACCTCGCTCTGCTAATCCTGTTACCAGTAGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTAGACTCAAGACGATAGTTACCGGATAAGGCGCtttccgtcccacctggtttaAGATGGCCTACCGGTTCAACGGCATCGGAGTGACACAGAATGTGCTGTACGAGAACCAGAAGCTGATCGCCAACCAGTTCAACAACGCCATCGGCAAGATCCAGGACAGCCTGA
Step 1. This is a picture of the gblock standard and the locations of the primers used in the PCR. Image
Step 2. Prepare serial dilutions of this gBLOCK standard. We use these concentrations and we dilute them in a solution of 0.3ng/ul human genomic DNA.. the HGDNA just prevents the gBLOCK standard from absorbing to the walls of the tube. Skip the HGDNA if you want to make fresh standard every week or if you use low-bind tubes.

a. 100,000 copies / 2ul
b. 10,000 copies / 2ul
c. 1,000 copies / 2ul
d. 100 copies / 2ul
e. 10 copies / 2ull
f. 0 copies / 2ul
Read 11 tweets
Apr 22, 2024
Plasmid DNA copy number quantification. protocols, reagents, and a thread of new results.
this is a map of the plasmid we sequenced from 2020 batches of mRNA vaccine. Image
we made a bunch of primer/probe pairs at IDT. here are the ones that worked the best.

SV40 FWD
TGTGGAATGTGTGTCAGTTAGG

SV40 REV
CACACCTGGTTGCTGACTAAT

SV40 PRB
/56-FAM/CCAGCAGGC/ZEN/AGAAGTATGCAAAGC/3IABkFQ/

Neo1 FWD
CGTTGGCTACCCGTGATATT

Neo1 REV
CTCGTCAAGAAGGCGATAGAAG

Neo1 PRB
/56-FAM/CCGCTTCCT/ZEN/CGTGCTTTACGGTAT/3IABkFQ/

Neo5 FWD
ACTGGGCACAACAGACAATC

Neo5REV
CCTCGTCTTGCAGTTCATTCA

Neo5 PRB
/56-FAM/TTTGTCAAG/ZEN/ACCGACCTGTCCGG/3IABkFQ/

pBR322-5 FWD
GTTTGTTTGCCGGATCAAGAG

pBR322-5 REV
CTAACTACGGCTACACTAGAAGAAC

pBR322-5 PRB
/56-FAM/TTCCGAAGG/ZEN/TAACTGGCTTCAGCA/3IABkFQ/

Spike1 FWD
CAGCTACCAGACACAGACAAA

Spike1 REV
GCGATAGAGTTGTTGGAGTAGG

Spike1 PRB
/56-FAM/AGCCAGAGC/ZEN/ATCATTGCCTACACA/3IABkFQ/

Spike N1 FWD
AGCCTACACCAACAGCTTTAC

Spike N1 REV
TGAAGAAAGGCAGGAACAGG

Spike N1 PRB
/56-FAM/CGACAAGGT/ZEN/GTTCAGATCCAGCGT/3IABkFQ/
Read 25 tweets
Feb 28, 2024
DNA methylation in NORMAL colon can identify who does and does not have colon cancer. its not perfect, but its pretty good. the loci that are differentially methylated between people with and without cancer are the same loci that change dramatically over time as people age. Cancer patients have normal colons that aged too quickly.
the developmental biologist will know why this is super interesting. HOX genes have the methylation age clock screwed up. Image
pretty wild. Image
Read 6 tweets
Feb 1, 2024
Friends, put this on blast worldwide.

I will check for DNA integration. Send me de-identified samples and I will PCR test them and sequence any positives.

You and your institution can remain anonymous and avoid the drama. promise.

@DrJBhattacharya @FLSurgeonGen @TheChiefNerd @drdrew

one useful type of sample would be archived tumor samples from cancers developing six months or more after exposure.
cardiac pathology samples from autopsies of heart attacks occurring less than one month after exposure.
Read 10 tweets
Aug 16, 2023
An open appeal to health care workers around the world. The Pfizer vaccine is contaminated with plasmid DNA. I want to test tissue and blood samples from people recently vaccinated and see if there is any evidence of this DNA integrating into host genomic DNA. PM me if you would like to help. Thanks. -Dr B.
but I think that today because of what people are worried about if I checked 20 or 30 cases of myocarditis, and they were all negative it would put some concerns to rest. And that would be a good thing. Alternatively, if I find it in the myocardium, or the pericardium we have an evidence of an easy fix to a serious problem
@KnowledgeAcqui1 @nellage but even PBMC’s from recently VAX people could be very useful, even if the results are negative. It could eliminate some possibilities.
Read 6 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Don't want to be a Premium member but still want to support us?

Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal

Or Donate anonymously using crypto!

Ethereum

0xfe58350B80634f60Fa6Dc149a72b4DFbc17D341E copy

Bitcoin

3ATGMxNzCUFzxpMCHL5sWSt4DVtS8UqXpi copy

Thank you for your support!

Follow Us!

:(