Kevin McKernan Profile picture
Apr 15, 2022 14 tweets 5 min read Read on X
Venomics to Snakes On a Plane.
Snake Oil or Venom?

This topic maybe toxic but it's largely a function of poor scientific communication and sticking to proper definitions.
I think everyone is up to speed on the fact that no venom has ever been detected in municipal water or remdesivir during the pandemic. This is just reckless speculation camouflaging legitimate concerns over the spike protein having SHORT peptide sequences related to Cobra.
This is better known as the SEB domain in Spike because it shares more homology with SEB than Cobra Toxin.
Can we call Spike protein a fully functional Venom as a result of this?

No!

Here is why.
comptes-rendus.academie-sciences.fr/biologies/arti…
Give the Cobra genome project paper a read.
You'll notice that venoms usually consist of 50-200 molecules that work in concert to kill you. Full length peptides (60-90aa) that fold properly. Not just a 7-10aa stretch that looks like a small piece of it.
nature.com/articles/s4158…
While venom has very emotive overtones in our society, not all venoms are poison. It is often the dose and the route of administration that makes the difference.
Bee Venom being used for treatment of SARs-CoV-2.
"VENOM!!!!"

frontiersin.org/articles/10.33…
Snake venom phospholipase A 2 being used to block SARs-CoV-2 from binding to ACE2.
"VENOM!!!"
pubmed.ncbi.nlm.nih.gov/34714362/
Components of venom are not a venom. Components of components of venom are not a venom. Protein folding via disulfide bridges is critical with venom peptides.
When you simply take a short amino acid stretch from a protein, you fail to replicate these secondary structures.
Route of administration matters. Your stomach wrecks most peptides. Snakes bypass this with injection... kinda like a spike vax. Many of the symptoms of venoms are broad just like COViD. But this is because venoms are rarely 1 compound.
Ddimer elevation-not specific to C19 infection.
Clotting-not specific.
Loss of taste and smell-not specific
Cytokine storms-not specific.
This is pleiotropic symptomatology.
Just because venoms and inflammatory viruses produce the same symptoms does not lead to 1 conclusion.
Spike protein has 7-10 amino acids that rhyme (not identical) with amino acids found in 60-90 amino acid long peptides found in venoms that have hundreds of components and genes involved in their synthesis. This is like saying "Theirs" and "The IRS" are the same... (pun intended)
I believe the SEB domain has clinical significance (mutated in omicron). I also realize this is still hypothetical. Weaponizing the story into "venom in the water&remdesivir" is hyperbolic grand standing when you have no data to support it being in either
osf.io/bcsa6/
In conclusion, you will see authors use terms like "neurotoxic-like" to signify that they are speaking to an incomplete mimetic of the molecule that may or may not embody the full length molecules function. This language is used because there is big diff between short sequence..
And known function.

We know C19 has a superantigen SEB domain, Not full length SEB. Cheng et al have done a lot of work to characterize this domain as being responsible for cytokine storms in MISC.

"venom in H20/Remdesivir" is return served Fear Porn. Noble lies are not noble

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Kevin McKernan

Kevin McKernan Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @Kevin_McKernan

Feb 7
The latest BS on @biorxivpreprint Image
This paper tries to makes claims of RT-qPCR sensitivity with a LLOQ of 372,800 molecules/ml as their lowest limit of Quantiation.

As a comparison, most clinical HIV RT-qPCR tests pick up 50 molecules/ml.
Hence they have very optimistic clearance rates.
biorxiv.org/content/10.648…
0.00085ng/ml is 372,800 copies. Image
Read 7 tweets
Jan 31
It is well known from BioNtech (Lenk et al) and Sutton et al (1997) that RNA:DNA hybrids inhibit DNaseI.

What is less known is that Quadruplex Gs also inhibit DNaseI. Some exist in SV40 and we get the most signal from this qPCR amplicon.

2 Different mechanisms of DNaseI inhibition = plasmid fragmentation cannot be assumed to be uniform in the mRNA vaccines. Hence 100 fold more spike than parts of the vector.

Below is a map of the codon optimized spike where Quadruplex Gs are overlaid with GAA repeats. GAA's are stickier RNA:DNA hybrids.

Our qPCR primers are overlayed as well.
@RetsefL @KUPERWASSERLAB @weldeiry @JesslovesMJK @DJSpeicher @TracyBethHoeg @DrJBhattacharyaImage
Evans et al demonstrate DNaseI is resistant to quadruplex Gs. They also move to alternative enzymes.
nature.com/articles/s4152…
This is from Lenk et al (BioNtech).
Note the concern over GAA sequences and RNA:DNA hybrids.
Our spike qPCR primers happen to land on GAA rich and quadruplex G rich regions of Spike.
frontiersin.org/journals/molec…Image
Read 4 tweets
Jan 30
@LocasaleLab I find the RNAi worship incongruent will how that entire field was ignored when injecting billions of people with mRNAs.
There are multiple 21bp homologies to human that emerged from the haphazard codon optimizations in the modRNA vaccine and no one cared?
@LocasaleLab Receipts.
Take Pfizers vax Sequence and run it through BLAT.
Hello... anyone from the RNAi space want to speak up about this? Image
ATGTTCGTGTTCCTGGTGCTGCTGCCTCTGGTGTCCAGCCAGTGTGTGAACCTGATCACCAGAACACAGTCATACACCAACAGCTTTACCAGAGGCGTGTACTACCCCGACAAGGTGTTCAGATCCAGCGTGCTGCACTCTACCCAGGACCTGTTCCTGCCTTTCTTCAGCAACGTGACCTGGTTCCACGCCATCTCCGGCACCAATGGCACCAAGAGATTCGACAACCCCGTGCTGCCCTTCAACGACGGGGTGTACTTTGCCAGCACCGAGAAGTCCAACATCATCAGAGGCTGGATCTTCGGCACCACACTGGACAGCAAGACCCAGAGCCTGCTGATCGTGAACAACGCCACCAACGTGGTCATCAAAGTGTGCGAGTTCCAGTTCTGCAACGACCCCTTCCTGGACGTCTACTACCACAAGAACAACAAGAGCTGGATGGAAAGCGAGTTCCGGGTGTACAGCAGCGCCAACAACTGCACCTTCGAGTACGTGTCCCAGCCTTTCCTGATGGACCTGGAAGGCAAGCAGGGCAACTTCAAGAACCTGCGCGAGTTCGTGTTTAAGAACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCTATCAACCTCGGCCGGGATCTGCCTCAGGGCTTCTCTGCTCTGGAACCCCTGGTGGATCTGCCCATCGGCATCAACATCACCCGGTTTCAGACACTGCTGGCCCTGCACAGAAGCTACCTGACACCTGGCGATAGCAGCAGCGGATGGACAGCTGGTGCCGCCGCTTACTATGTGGGCTACCTGCAGCCTAGAACCTTCCTGCTGAAGTACAACGAGAACGGCACCATCACCGACGCCGTGGATTGTGCTCTGGATCCTCTGAGCGAGACAAAGTGCACCCTGAAGTCCTTCACCGTGGAAAAGGGCATCTACCAGACCAGCAACTTCCGGGTGCAGCCCACCGAATCCATCGTGCGGTTCCCCAATATCACCAATCTGTGCCCCTTCGACGAGGTGTTCAATGCCACCAGATTCGCCTCTGTGTACGCCTGGAACCGGAAGCGGATCAGCAATTGCGTGGCCGACTACTCCGTGCTGTACAACTTCGCCCCCTTCTTCGCATTCAAGTGCTACGGCGTGTCCCCTACCAAGCTGAACGACCTGTGCTTCACAAACGTGTACGCCGACAGCTTCGTGATCCGGGGAAACGAAGTGCGGCAGATTGCCCCTGGACAGACAGGCAACATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGTGTGATTGCCTGGAACAGCAACAAGCTGGACTCCAAAGTCGGCGGCAACTACAATTACAGGTACCGGCTGTTCCGGAAGTCCAATCTGAAGCCCTTCGAGCGGGACATCTCCACCGAGATCTATCAGGCCGGCAACAAGCCTTGTAACGGCGTGGCAGGCGTGAACTGCTACTTCCCACTGCAGTCCTACGGCTTTAGGCCCACATACGGCGTGGGCCACCAGCCCTACAGAGTGGTGGTGCTGAGCTTCGAACTGCTGCATGCCCCTGCCACAGTGTGCGGCCCTAAGAAAAGCACCAATCTCGTGAAGAACAAATGCGTGAACTTCAACTTCAACGGCCTGACCGGCACCGGCGTGCTGACAGAGAGCAACAAGAAGTTCCTGCCATTCCAGCAGTTTGGCCGGGATATCGCCGATACCACAGACGCCGTTAGAGATCCCCAGACACTGGAAATCCTGGACATCACCCCTTGCAGCTTCGGCGGAGTGTCTGTGATCACCCCTGGCACCAACACCAGCAATCAGGTGGCAGTGCTGTACCAGGGCGTGAACTGTACCGAAGTGCCCGTGGCCATTCACGCCGATCAGCTGACACCTACATGGCGGGTGTACTCCACCGGCAGCAATGTGTTTCAGACCAGAGCCGGCTGTCTGATCGGAGCCGAGTACGTGAACAATAGCTACGAGTGCGACATCCCCATCGGCGCTGGAATCTGCGCCAGCTACCAGACACAGACAAAGAGCCACCGGAGAGCCAGAAGCGTGGCCAGCCAGAGCATCATTGCCTACACAATGTCTCTGGGCGCCGAGAACAGCGTGGCCTACTCCAACAACTCTATCGCTATCCCCACCAACTTCACCATCAGCGTGACCACAGAGATCCTGCCTGTGTCCATGACCAAGACCAGCGTGGACTGCACCATGTACATCTGCGGCGATTCCACCGAGTGCTCCAACCTGCTGCTGCAGTACGGCAGCTTCTGCACCCAGCTGAAAAGAGCCCTGACAGGGATCGCCGTGGAACAGGACAAGAACACCCAAGAGGTGTTCGCCCAAGTGAAGCAGATCTACAAGACCCCTCCTATCAAGTACTTCGGCGGCTTCAATTTCAGCCAGATTCTGCCCGATCCTAGCAAGCCCAGCAAGCGGAGCTTCATCGAGGACCTGCTGTTCAACAAAGTGACACTGGCCGACGCCGGCTTCATCAAGCAGTATGGCGATTGTCTGGGCGACATTGCCGCCAGGGATCTGATTTGCGCCCAGAAGTTTAACGGACTGACAGTGCTGCCTCCTCTGCTGACCGATGAGATGATCGCCCAGTACACATCTGCCCTGCTGGCCGGCACAATCACAAGCGGCTGGACATTTGGAGCAGGCGCCGCTCTGCAGATCCCCTTTGCTATGCAGATGGCCTACCGGTTCAACGGCATCGGAGTGACCCAGAATGTGCTGTACGAGAACCAGAAGCTGATCGCCAACCAGTTCAACAGCGCCATCGGCAAGATCCAGGACAGCCTGAGCAGCACAGCAAGCGCCCTGGGAAAGCTGCAGGACGTGGTCAACCACAATGCCCAGGCACTGAACACCCTGGTCAAGCAGCTGTCCTCCAAGTTCGGCGCCATCAGCTCTGTGCTGAACGATATCCTGAGCAGACTGGACCCTCCTGAGGCCGAGGTGCAGATCGACAGACTGATCACAGGCAGACTGCAGAGCCTCCAGACATACGTGACCCAGCAGCTGATCAGAGCCGCCGAGATTAGAGCCTCTGCCAATCTGGCCGCCACCAAGATGTCTGAGTGTGTGCTGGGCCAGAGCAAGAGAGTGGACTTTTGCGGCAAGGGCTACCACCTGATGAGCTTCCCTCAGTCTGCCCCTCACGGCGTGGTGTTTCTGCACGTGACATATGTGCCCGCTCAAGAGAAGAATTTCACCACCGCTCCAGCCATCTGCCACGACGGCAAAGCCCACTTTCCTAGAGAAGGCGTGTTCGTGTCCAACGGCACCCATTGGTTCGTGACACAGCGGAACTTCTACGAGCCCCAGATCATCACCACCGACAACACCTTCGTGTCTGGCAACTGCGACGTCGTGATCGGCATTGTGAACAATACCGTGTACGACCCTCTGCAGCCCGAGCTGGACAGCTTCAAAGAGGAACTGGACAAGTACTTTAAGAACCACACAAGCCCCGACGTGGACCTGGGCGATATCAGCGGAATCAATGCCAGCGTCGTGAACATCCAGAAAGAGATCGACCGGCTGAACGAGGTGGCCAAGAATCTGAACGAGAGCCTGATCGACCTGCAAGAACTGGGGAAGTACGAGCAGTACATCAAGTGGCCCTGGTACATCTGGCTGGGCTTTATCGCCGGACTGATTGCCATCGTGATGGTCACAATCATGCTGTGTTGCATGACCAGCTGCTGTAGCTGCCTGAAGGGCTGTTGTAGCTGTGGCAGCTGCTGCAAGTTCGACGAGGACGATTCTGAGCCCGTGCTGAAGGGCGTGAAACTGCACTACACATGATGA
Read 8 tweets
Jan 19
On Veterans Day @CharlesRixey @JesslovesMJK
Stopped by MGC.

2 long days later we had all of his data.

It’s now published in The Journal of Independent Medicine.

It describes the mechanism of failure for the DNA contamination in the mRNA shots and why the regulators are missing it.
@JesslovesMJK @CharlesRixey @weldeiry @KUPERWASSERLAB @RetsefL @DrJBhattacharya @RWMaloneMD @RobertKennedyJr @TracyBethHoegImage
Image
Image
Image
Image
Read 5 tweets
Dec 19, 2025
Another Achs et al Fumble uncovered.
These folks don't even understand Capillary Electrophoresis.

Its becoming increasingly clear these are not honest mistakes but designed to deceive by people who are employed at a Vaccine Research Institute.
Science for Sale.

@JesslovesMJK @DJSpeicherImage
Here is the Rub.
They used a CE instrument that has a lower limit of sensitivity above the 10ng limit.
You need to be able to pick up 10X below the 10ng limit. Or 33pg/ul (300ul dose @ 10ng = 33pg/ul) Image
This is embarrassingly rigged or they are incompetent.
They ignored our comments on the preprint server and raced their paper into @Nature.

@JesslovesMJK and @DJSpeicher have their own substacks picking up other errors in this paper I'll post sortly. Image
Read 5 tweets
Dec 15, 2025
Image
Image
Note, its unique to that wonderful Furin Cleavage site. Image
Read 4 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Don't want to be a Premium member but still want to support us?

Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal

Or Donate anonymously using crypto!

Ethereum

0xfe58350B80634f60Fa6Dc149a72b4DFbc17D341E copy

Bitcoin

3ATGMxNzCUFzxpMCHL5sWSt4DVtS8UqXpi copy

Thank you for your support!

Follow Us!

:(