The biggest recruiter by far is site 1231.
In Argentina. Well of course, for a joint German-American drug where else?
Site 1231 recruited 4501 patients.
That is 10% of the patients AT ONE SITE.
ALL 4501 patients were recruited in 3 weeks.
WOW!
This is site 1231 from the @ICANdecide log
Recognise the name?
We'll come back to him in a sec....
The site is supposed to be the Military Central Hospital.
That's interesting.
It's also an interesting logo.
Seems to have given David Martin ideas for his website logo, but probably just coincidence. I dunno...
Anyway, it seems a bit odd that a principal investigator (who has to be a medical doctor) of a major international study is recruiting 4500 patients in 3 weeks at one site, without a CRO.
And working 7 days a week. No gaps. Recruitment every day incl Sat/Sun
@IamBrookJackson
Weekend recruitment for a clinical trial would be odd. Staff are needed to fill out that many record forms (CRFs) and there are potential risks to the trial, so you need medical staff. It would be highly unusual.
So who is he?
Here is his trial CV
Wait, hang on.
This is Fernando Polack.
The Fernando Polack who claims to be at Vanderbilt (USA) at the same time.
Who also happens to make appearances for the FDA...
Who also happens to work for The Infant Foundation and also happens to be funded by the Bill & Melinda Gates Foundation and the NIH
He is literally the busiest doctor on the planet infant.org.ar
But managed to find enough time to be the lead author on the #BNT162b2 paper (with all of Pfizer's scientists)
Yet while doing all this, he managed to find time to (presumably single-handedly because no other authors are listed at that site) recruit 4500 patients in 3 weeks, with each patient requiring 250 PAGES of case report forms (CRFs).
That is 1,125,000 pages of CRFs.
In 3 weeks.
But I'm sure that's totally above board until we get to the next totally above board feature of the fastest 44,000 patient study ever in history....
#site4444
WTF is site 4444?
@IamBrookJackson
There were 270 clinical recruitment sites for the Pflzer vaccine study, numbered consecutively from 1001 to 1270.
There are all listed here.
This is the last page.
There is no site 1271.
There is no other site with a number above 1270. icandecide.org/wp-content/upl…
Well that's a bit of a problem because...
There are a lot of entries in the randomisation log for #site4444.
1275 patients to be exact.
About 3% of the total.
And you know what?
All 1275 "patients" were recruited in one week - from 22nd to 27th September 2020.
• • •
Missing some Tweet in this thread? You can try to
force a refresh
@jsm2334 I have 3 new questions:
1⃣ why didn't you appear on the Razzaghi paper using your data?
2⃣ is your data synthetic?
3⃣ what is the binomial probability that 18/20 of a university's research team come from a group that comprises 2% of the US population, if all groups are equal?
@jsm2334 For those confused... The original thread on #OHDSI - the data curators claiming an impossible 96% efficacy rate for a type-mismatched vaccine against infection - is here.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1