Jikkyleaks 🐭 Profile picture
Home for @jikkykjj the whistleblowing lab mouse #Modernagate #CTCCTCGGCGGGCACGTAG #3Tablets Pronouns: mouse/mouseself Tweets are public interest disclosures
59 subscribers
Jul 7 4 tweets 2 min read
The significance of yesterday's #Grokgate scandal cannot be understated.

Grok not only lied but lied about lying. Multiple times.

The reason it's so significant is that you are now going to enter a world of AI based medicine and it doesn't matter whether it's true or not, you better damn well take the drugs.

You see, when you lie about one thing to cover up another lie you can never be trusted in anything ever.

Grok fabricated a picture of a phone screen to show that a SpaceX rocket landing, which was fake footage, was real. That was to avoid the inevitable questions over where SpaceX money is going.

Do you want to live in a world where all your medical treatments are based on fabrications and hallucinations and the only thing that matters is that the corporations behind them keep getting paid?

Grok is that world.
Look at this picture which was fabricated by Grok earlier this year.

This is your next medical treatment. It will be as reliable as a SpaceX rocket.Image Original SpaceX rocket thread
Jul 7 8 tweets 3 min read
🚨🚨Breaking:
@Grok's NDA with Pfizer rests with @xai

Awaiting full disclosure.

x.com/i/grok/share/R… Before they all get deleted

Image
Jun 29 6 tweets 2 min read
WHOA!

What @TheBurninBeard is saying here is that the clinical samples that had "COVID" also had gene signatures of Mycoplasma fermentans, a US military pathogen that can be used as a vector to carry viral clones.

@SabinehazanMD found it too.
🧵
#spraygate @BrokenTruthTV Can you see that Norman Pieniazek, who headed up the CDC's research division at the time that the @CDCgov sent biological weapons to Iraq to start a war, took himself out of this thread?

Do you know why?
@SecKennedy does.

Jun 28 14 tweets 9 min read
I am not sure which is the more damning.

@RWMaloneMD's incisive question because he knows that the @CDCFlu and DARPA keep the influenza gravy train running via GOFROC.

Or the uncomfortable silence from the rest of the "experts" at the end.
archive.md/IJJ0T x.com/Jikkyleaks/sta… @RWMaloneMD @CDCFlu Nothing to see here
medschool.duke.edu/blog/weapon-ma…Image
Jun 26 4 tweets 4 min read
"Not a single death. "

While everybody was being distracted by the Shah of Trumpran and RFK's wearables nobody actually noticed that the CDC's "public health" department is run by the US military with US military mentality in US military uniforms.

Here is 30 minutes of CAPTAIN Sarah Meyer gaslighting the US public.

If this doesn't make you angry it's likely nothing will.
"No deaths".
"All benefit".
"Don't worry about myocarditis" (which has a 10 year mortality of up to 50%).
Her lapdog Adam McNeil isn't even a doctor and blatantly lies about the net mortality benefit of the COVID vaccines, never seen in a single RCT.

The US military has been forcing experimental vaccines on their soldiers for ever, and they don't give a damn about what happens as a result because YOU will pay the bill.

And if a soldier dies they will just send another soldier to take the spouse a folded up flag. They do not care one iota that your rights to bodily autonomy were trampled on and people died, because they will tell you that nobody died.

And you will shut the hell up, peasant.

CAPTAIN Meyer was part of the ACIP committee that approved the Pfizer vaccine claiming that it reduced infections by 92%. She lied then and she's lying now - because if she admitted that people died, she would be responsible.

Is lying to the public as a commissioned officer treason, or just another reason for a pat on the back from the US military?

Another job done. Crisis averted. Nobody goes to jail. No grand juries. No courts martial.
Chin chin.
usphs.gov

@RetsefL @RWMaloneMD @MaryanneDemasi @Fynnderella1 @CharlesRixey @Kevin_McKernan @RMConservative @MdBreathe @DrJBhattacharya Except she didn't apologize - for the deaths and adverse events.
Neither did the @CDCgov
Nor did the @US_FDA.

The @usphscc medical symbol is the false caduceus and is claimed by some to be intentionally a misdirection of medicine.

@ClareCraigPath pmc.ncbi.nlm.nih.gov/articles/PMC44…Image
Image
May 28 5 tweets 2 min read
POLL:

Do you think Francesca Gino was set up by Dan Ariely at Harvard for leverage over her silence on what actually happened during COVID in Italy?

#GinoGate Ariely, known to have a history of research fraud, self declaring here that he was working for the "Israeli government" during COVID.

Nudgestock. The psychology of nudging you into doing what the government and pharma corporations want.

Protected?
May 2 4 tweets 3 min read
"Look over here not there"

HPV vaccine "success" explained in one chart.

Every vaccine scientist will try to convince you that the drop in u25 cancers was due to the vaccine when it was merely due to the change in screening.

But check out the HUGE RISE in 25+ cancers. This pattern is repeated in Scotland and Australia where similar changes to the screening age were made a few years after the introduction of coerced vaccination, obfuscating the figures to hide a scandalous rise in 25-29 age cervical cancers after the vaccine rollout.

For clarity most cancers in this age group are early and detected on screening before they become advanced. Moving the screening age meant that they were diagnosed later and therefore in an older age bracket.

@DrSuzanneH7
@MaryanneDemasi
@DrJulieSladden
@DrJBhattacharya
@missyTHX1138
@stkirsch
@SecKennedyImage The big red arrow is pointing to the preinvasive diagnoses which tend to mirror the actual cancers - the upper chart was too busy.

Here is the same from the OP with arrows showing both cancer (above) and precancer (below) which both rose significantly after the vaccine rollout Image
Apr 23 7 tweets 3 min read
This is the psychopathic research group from the UK that has just decided to fly planes into the clouds to block out the sun.

Crazy scientists like this have killed tens of millions in the last century.

DARPA killed the ozone layer in 1958.
This mob includes Nathan Wolfe. A reminder. Nathan Wolfe is Metabiota. The Clinton's conduit for biological weapons manufature.
arkmedic.info/p/actuaries-inc
Apr 18 8 tweets 3 min read
Please understand how important this is.

Two major papers showed that the COVID vaccine spike protein causes cancer by suppression of p53.

The authors of both have been threatened into retracting their papers by pharma groups tied to the NIH.

That's why it's called #NIHgate Exhibit A
arkmedic.info/p/welcome-to-g…
Apr 17 6 tweets 4 min read
Imagine a company so large that they can recruit thousands of "experts" yet you've never heard of them.

And imagine that those recruited scientists include agents of #PubpeerGate whose job is to silence other scientists.

@secgov @Kevin_McKernan @SabinehazanMD Image @SECGov @Kevin_McKernan @SabinehazanMD Wow so this company is claiming influence with 11,000 scientists and multiple links lead back to pharma and the gene therapy corporations.

Broad institute. Who could have guessed?
#pubpeergate

putassoc.com/about-us/meet-…Image
Image
Image
Image
Feb 23 5 tweets 5 min read
WHOA!!! 🧀

@Yale could be up to their necks in the biggest HIPAA scandal since @UChicago

This is how the scam appears to have worked.

Harlan Krumholz owns a patent for managing health data through an app. "Hugo health" was the middle man providing the app to bait people claiming to be vaccine injured to join a study called LISTEN. But it was essentially being run on behalf of Pfizer/Janssen who paid him $3m in "research grants".

Thousands of injured signed up but only 241 patients were used in the "study" of which the publications were irrelevant and showed nothing other than "the vaccines saved millions of lives" bla bla. Nothing helpful for the vaccine injured at all.

But the bombshell - the data that they provided was able to be sold off to anyone they wanted to. It was in the consent form that most people didn't read. The data was held on hugo.health which has now gone. It was NOT HIPAA compliant.

How did we know that hugo.health's servers were not HIPAA compliant?

Yale told the participants in a email in July 2024 (attached).

So where did all that health data go?

Was it sold off to the highest bidder or used in a blackmail campaign against vulnerable people who were vaccine injured and couldn't work? (Like those that have targeted our accounts recently)

We don't know. But you can be damn sure that Yale knows, and took secret action to remedy the situation having already taken millions of dollars from pharma to run studies that undermined the vaccine injured.

That is why there is so much animosity suddenly being directed at the vaccine injured. They want to bury this story.

Yale could be in very big trouble.
They deserve a hashtag.
#YaleGate

@RobertKennedyJr @SECGov @AGHuff @chrismartenson

Patent:
patents.justia.com/inventor/harla…
Pubmed showing over 1000 papers (not possible for a clinician researcher writing his own papers):
pubmed.ncbi.nlm.nih.gov/?term=krumholz…
LISTEN studies:
pubmed.ncbi.nlm.nih.gov/?term=krumholz…Image
Image
Image
@Yale @UChicago For those confused, please understand what a "limited hangout" is here. While you are rejoicing on the scraps of Daily Mail fodder, the pharma companies' new narrative is enshrined by those very articles.

"Injuries are very rare but it was worth it"

Dec 12, 2024 4 tweets 2 min read
@jsm2334 I have 3 new questions:
1⃣ why didn't you appear on the Razzaghi paper using your data?
2⃣ is your data synthetic?
3⃣ what is the binomial probability that 18/20 of a university's research team come from a group that comprises 2% of the US population, if all groups are equal? Image
Image
@jsm2334 For those confused... The original thread on #OHDSI - the data curators claiming an impossible 96% efficacy rate for a type-mismatched vaccine against infection - is here.

This is not their first rodeo in synthetic data

#EMRgate #Surgisphere

Nov 10, 2024 5 tweets 3 min read
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 No. They have not monitored them. We have an FOI on this @LostInTheNet1 @Truelovefaith1 @man_rocket97805 TGA FOI 5274. Refused.
(part 1 of 2).

The TGA has no idea how many miscarriages occurred after COVID vaccination because they had no interest.

Their only interest is in protecting their income stream and the Bollinger.

@SenatorRennick @DrJulieSladden @BroadbentMP Image
Image
Image
Image
Nov 7, 2024 7 tweets 5 min read
Are you looking for this @VaccineMole ?

Declared "BGH polyA" sequence (226bp): CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTG
CCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTAT
TCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGAT
GCGGTGGGCTCTATGG

Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC

So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...

jbc.org/article/S0021-…

I'll try and find the missing sequence
#SV40Gate #PlasmidGateImage
Image
@Kevin_McKernan @VaccineMole Add in a CMV promoter for good measure and perhaps a soupcon of cancer to boot.

THIS IS WHY YOU DO NOT PUT PLASMIDS INTO LIPID NANOPARTICLES AND TRANSFECT THEM INTO HUMANS.
pmc.ncbi.nlm.nih.gov/articles/PMC26…

x.com/Jikkyleaks/sta…
Aug 10, 2024 4 tweets 3 min read
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT… @DiedSuddenly_ Addendum: Some undeclared replication of images from the Jeon paper in 2022, same journal.
Jeon (left):
Lee (right):


@JesslovesMJK @Kevin_McKernan
#NanoGate ijvtpr.com/index.php/IJVT…
mail.ijvtpr.com/index.php/IJVT…

Image
Image
Aug 10, 2024 4 tweets 4 min read
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag

My view reading this is:

This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.

I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.Image
Image
Image
Image
@DiedSuddenly_ A bowling alley?

I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.

This was from 2022:


I wonder if they targeted Broudy to add some credence to the LARP. ijvtpr.com/index.php/IJVT…

Image
Image
Jun 16, 2024 4 tweets 2 min read
@SenatorRennick The #3tablets protocols and #midazolam murders were the primary drivers of "COVID" death prior to the GMO rollout.

The publishers, who remain nameless, should be called to give evidence.covid19evidence.net.au What in the holy hell?

The website which was used to propagandise the treatment of COVID during 2020-2024, and withhold effective treatments from people who then died..

Is now an air freight site.

THIS IS WHY WE ARCHIVE.

@tonynikolic10 @BroadbentMPcovid19evidence.net.auImage
https://archive.is/dEBZ1
Jan 25, 2024 9 tweets 4 min read
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health? @JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.

It's like Georgia. Someone flood the polling station quick! Image
Oct 28, 2023 9 tweets 3 min read
BOOM 💥💥
It's a gene therapy.
It was a gene therapy yesterday.
It will still be a gene therapy tomorrow.
With a plasmid, it's two gene therapies.

The OGTR confirms:
"Under the gene technology act an [OGTR] approval would have been required"

@SenatorRennick @double_christ @SenatorRennick @Double_Christ This was a lie from Dr Raj Bhula.
It's transfection.
It's in the Pfizer documents that the TGA have.
Everybody knows it's transfection.
If Dr Bhula doesn't know, she should resign immediately.
The OGTR failed.
Oct 25, 2023 7 tweets 3 min read
Hi @peterdaszak now that I have your attention why did Alice Latinne hide those viral sequences from your 2019 Nature paper, and where did the GP-120 sequences come from?

Asking for 6.9m people who can't, because they died.

.
@chrismartenson
Image Reminder
Oct 23, 2023 7 tweets 3 min read
Well, it used to be rare.

This is the same rare lymphoma that Michel Goldman wrote about developing after a COVID mRNA "vaccine".

(see next tweet).
news.com.au/entertainment/…

Image Michel Goldman's story in the Atlantic
archive.is/S3xXz