Share this page!

Enter URL or ID to Unroll

You can paste full URL like: https://x.com/threadreaderapp/status/1644127596119195649
or just the ID like: 1644127596119195649

How to get URL link on X (Twitter) App

  1. On the Twitter thread, click on or icon on the bottom
  2. Click again on or Share Via icon
  3. Click on Copy Link to Tweet
  4. Paste it above and click "Unroll Thread"!
  5. More info at Twitter Help
Jikkyleaks 🐭 Profile picture
Jikkyleaks 🐭
@Jikkyleaks
Home for @jikkykjj the whistleblowing lab mouse #Modernagate #CTCCTCGGCGGGCACGTAG #3Tablets Pronouns: mouse/mouseself Tweets are public interest disclosures
57 subscribers
Nov 10 • 5 tweets • 3 min read
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 No. They have not monitored them. We have an FOI on this @LostInTheNet1 @Truelovefaith1 @man_rocket97805 TGA FOI 5274. Refused.
(part 1 of 2).

The TGA has no idea how many miscarriages occurred after COVID vaccination because they had no interest.

Their only interest is in protecting their income stream and the Bollinger.

@SenatorRennick @DrJulieSladden @BroadbentMP Image
Image
Image
Image
Nov 7 • 7 tweets • 5 min read
Are you looking for this @VaccineMole ?

Declared "BGH polyA" sequence (226bp): CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTG
CCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTAT
TCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGAT
GCGGTGGGCTCTATGG

Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC

So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...

jbc.org/article/S0021-…

I'll try and find the missing sequence
#SV40Gate #PlasmidGateImage
Image @Kevin_McKernan @VaccineMole Add in a CMV promoter for good measure and perhaps a soupcon of cancer to boot.

THIS IS WHY YOU DO NOT PUT PLASMIDS INTO LIPID NANOPARTICLES AND TRANSFECT THEM INTO HUMANS.
pmc.ncbi.nlm.nih.gov/articles/PMC26…

x.com/Jikkyleaks/sta…
Aug 10 • 4 tweets • 3 min read
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT… @DiedSuddenly_ Addendum: Some undeclared replication of images from the Jeon paper in 2022, same journal.
Jeon (left):
Lee (right):


@JesslovesMJK @Kevin_McKernan
#NanoGate ijvtpr.com/index.php/IJVT…
mail.ijvtpr.com/index.php/IJVT…

Image
Image
Aug 10 • 4 tweets • 4 min read
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag

My view reading this is:

This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.

I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.Image
Image
Image
Image @DiedSuddenly_ A bowling alley?

I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.

This was from 2022:


I wonder if they targeted Broudy to add some credence to the LARP. ijvtpr.com/index.php/IJVT…

Image
Image
Jun 16 • 4 tweets • 2 min read
@SenatorRennick The #3tablets protocols and #midazolam murders were the primary drivers of "COVID" death prior to the GMO rollout.

The publishers, who remain nameless, should be called to give evidence.covid19evidence.net.au What in the holy hell?

The website which was used to propagandise the treatment of COVID during 2020-2024, and withhold effective treatments from people who then died..

Is now an air freight site.

THIS IS WHY WE ARCHIVE.

@tonynikolic10 @BroadbentMPcovid19evidence.net.auImage
https://archive.is/dEBZ1
Jan 25 • 9 tweets • 4 min read
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health? @JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.

It's like Georgia. Someone flood the polling station quick! Image
Oct 28, 2023 • 9 tweets • 3 min read
BOOM 💥💥
It's a gene therapy.
It was a gene therapy yesterday.
It will still be a gene therapy tomorrow.
With a plasmid, it's two gene therapies.

The OGTR confirms:
"Under the gene technology act an [OGTR] approval would have been required"

@SenatorRennick @double_christ @SenatorRennick @Double_Christ This was a lie from Dr Raj Bhula.
It's transfection.
It's in the Pfizer documents that the TGA have.
Everybody knows it's transfection.
If Dr Bhula doesn't know, she should resign immediately.
The OGTR failed.
Oct 25, 2023 • 7 tweets • 3 min read
Hi @peterdaszak now that I have your attention why did Alice Latinne hide those viral sequences from your 2019 Nature paper, and where did the GP-120 sequences come from?

Asking for 6.9m people who can't, because they died.

.
@chrismartenson
Image Reminder
Oct 23, 2023 • 7 tweets • 3 min read
Well, it used to be rare.

This is the same rare lymphoma that Michel Goldman wrote about developing after a COVID mRNA "vaccine".

(see next tweet).
news.com.au/entertainment/…

Image Michel Goldman's story in the Atlantic
archive.is/S3xXz
Oct 22, 2023 • 15 tweets • 7 min read
Were the claims made in this press conference by a high profile CNN doctor true?

Watch the conference clip and follow the thread below. It is impossible to know what is happening in another part of the world unless you are there.

But the statements made by Gassan Abu-Sittah cannot be true as made.

If not true they could even qualify as an incitement to further violence. Image
Oct 18, 2023 • 13 tweets • 5 min read
The author of the BMJ article quoted by Viki as if it is gospel is a freelance journalist. He chose not to include that qualifier in this BMJ piece.

This tweet from Viki is propaganda because it suggests something that is not true, adding the @bmj_latest label for authenticity @bmj_latest Here is the request for the data underlying the MBRRACE report.

Data from the @NPEU_UKOSS has previously been requested under FOI and denied.

This is not their data, it belongs to the British public who fund them.

Oct 16, 2023 • 12 tweets • 5 min read
Fake cheese 🧀🧀

Schrodinger's science, on orders.

While Trump is in office "don't rush the vaccines".
Months later "get them here asap".

Yet the story in this tweet was never possible as a natural phenomenon. It was a lie.

Incidentally, DARPA funds Simine.

Thread 🧵

Image
Image This was the story.
It was fake because it's not possible.
I'll tell you why.

The claim: "Out of 30 people at the event 24 unvaccinated were infected, and 6 vaccinated were not infected"

abc.net.au/news/2021-06-2…
Image
Oct 14, 2023 • 4 tweets • 2 min read
Put your hand up if you think that using a biological system derived from the only organism that thrives at 100 degrees celsius (pyrococcus furiosus)...
to generate synthetic viral spike proteins...

Is a good idea.

Poll in tweet below.
nature.com/articles/s4159… POLL:
Using pyrococcal biological systems to generate synthetic viral spike proteins is...

en.wikipedia.org/wiki/Pyrococcu…
Oct 12, 2023 • 10 tweets • 4 min read
WHOA! 🧀🧀🧀
This could be the worst paper that @thelancet have published since the #surgisphere fraud.

Kristine Macartney, who received $65m in government grants to push COVID vaccines, tells us it prevents non-COVID deaths.

Not a chance.
🧵

thelancet.com/journals/lanwp… Here is just one of the most ridiculous graphs I have ever seen in a paper.

The "Dose 2 > 180 days" group had the exact same mortality rate. So the "vaccine efficacy" in this group was 34%. With tight confidence intervals.

Not a chance. Image
Oct 6, 2023 • 7 tweets • 3 min read
Where are they now?
archive.is/1lEw4
1967: Robert Maxwell during his term as Labour MP for Buckingham, with his wife, Elizabeth, and their children, clockwise from left: Philip, Ian, Isabel, Kevin, Christine, Anne and Ghislaine As an aside, Maxwell House was literally the worst coffee ever made.

No contest. Image
Oct 3, 2023 • 7 tweets • 3 min read
For pointing out that DARPA were behind the organisation that did the fundraiser for #DataColada I was harassed with "conspiracy" labelling.

Now it is confirmed - what?
We're just moving on to the next propaganda drive?

No.
People died because of these psyops.

#GinoGate

Image
Image The prior threads. Worth reading the replies before they get shredded
Sep 30, 2023 • 6 tweets • 3 min read
It's a long way to send a swab, don't you think?

When you understand that the patients in the Pfizer vaccine trials did not have their "COVID" diagnosed on the basis of the swab that they sent in, it should become clear how the result was obtained.
files.catbox.moe/pikoi0.pdf

Image To reiterate.
If you were in the trial and had COVID symptoms, you took your own swab and sent it into to Pfizer at Pearl River, who then sent it to Wuhan.
The COVID case was not recorded in the trial on the basis of your local test (e.g. with your GP)
Sep 27, 2023 • 4 tweets • 2 min read
Absolutely nothing to see here.

Because there is nothing to see here, there is no need to check the next tweet.

Thank you. Have a great day.

#NLS #Plasmidgate Image Of course that can't code, because it's the 3' UTR (untranslated region). Which obviously doesn't get translated.

Unless the uridines are pseudouridine.

Maybe it's just another accident.
Yep. Hanlon's razor.

@P_J_Buckhaults @Kevin_McKernan
ncbi.nlm.nih.gov/pmc/articles/P…
Image
Sep 25, 2023 • 5 tweets • 2 min read
#NLSGate #Novagate #Plasmidgate Image #NLSGate #Novagate #Plasmidgate Image
Sep 23, 2023 • 8 tweets • 3 min read
Wait what?
What's a "avid anti-vaxxer"?
Where did I ever claim to be an "avid anti-vaxxer"?
It's just another lazy slur.

And why is it necessary to mischaracterise someone instead of debating scientific papers that have been presented?

@weldeiry I'm sorry you've been targeted Image @weldeiry A reminder as to our previous attempts to "debate" "Debunk_the_Funk".

It's always the same MO:
▶ Makes false claims
▶ Gets shown data
▶ Resorts to insults and calls in the #muttoncrew

Sep 21, 2023 • 7 tweets • 3 min read
I'm going to have to block him again. Can't say I didn't try. The goalpost shifting on this thread even made me dizzy and the insults he had to resort to were disappointing to see from a scientist.

@Topaz20211 you have more patience than me Here is just one tweet from the thread where he was attacking Phillip Buckhaults who ended up deleting his account, and Wafik El Deiry. Both those people have h-indices that embarrass Dan.

He can't argue science so recruits #muttoncrew trolls.