Kevin McKernan Profile picture
May 19, 2022 25 tweets 10 min read Read on X
Compounding error

Transcriptional error and Translational error.

The mRNA jabs use a RNA polymerase to synthesize mRNA from a DNA plasmid.
They replace U with m1pU.

The error rate jumps to 100-300 errors per million bases. That’s 10-^3 -> 10-^4 error

biorxiv.org/content/10.110… Image
The vax is ~4200bp.
This is approximately 1 error in every vax molecule and you get injected with 40T.

This is a result of m1pU which is a low fidelity base. This low fidelity also impacts the next step of tRNA hybridization in translation.
This is compounding error. Image
Pfizer has mostly sold this base replacement as improving the magnitude and durability of expression.

As with many things in biology, when you optimize for the magnitude of expression, you sacrifice fidelity. Image
Many think of variants as from the virus, not the vax
The virus has an ExoN gene to error correct the polymerase errors. These error correcting proteins don’t like low fidelity bases like m1pU
In order maximize expression of m1pU they need sloppy enzymes

pnas.org/doi/10.1073/pn… Image
As for IVT polymerase error rate, I’d like to emphasize that the folks from New England Biolabs are no hacks when it comes to enzymology.

Their founder Rich Robert’s won the Nobel prize for the discovery of restriction enzymes and they have been the gold standard for decades. Image
The problem is more pronounced with translation.
This model is changing only a few codons. Change them all I bet the error rate escalates.

pnas.org/doi/10.1073/pn… Image
Add the transcriptional and translational compounded error and you have a combinatorial biochemistry problem on every injection.

This is why there is raw sequence data for vax lots in NCBI.
There is no peptide sequence of one of these mRNA libraries in NCBI.
Just smears on gels. Image
This is a highly variable prodrug.
The final drug has never been characterized.

There are 3D structures of protein translated from mRNA transcribed from a DNA construct without m1pU. Not relevant. No m1pU. ImageImage
There are also smeary antibody stained western blots.
Antibody stains are biased toward error free proteins. They don’t tag the mutated ones.

Need to stain everything.
Cell free in vitro TNT to understand glycosylation or PNGase F for removing in vivo glycosylation. More ?s. ImageImage
In summary, no mRNA injection should ever escape lot to lot sequence QC that is sensitive enough to find parts per thousand error. 40T molecules injected means small % error = billions of contaminants.
Protein sequencing of the final drug should be required.
This is why there is NO lot to lot raw sequence data in NCBI.^^^^
To simplify, the error measured by Chen et al, suggests 1 error in every mRNA molecule. Poisson would imply some molecules have 2 and 3 errors and many have zero.

Now imagine you inject 40 Trillion molecules where each one is different.

The combinatorics are mind blowing.
The good news is that folk at BASE are starting to look at this problem with direct RNA sequencing with Oxford Nanopore (ONT). But the m1pUs look foreign to the ONT platform and get called as both a C and a T. It's unlikely this will have the accuracy to pick up 1:1K heteroplasmy Image
The bad news is, this should have been done and made public before injecting 1B people. Its pretty bleeding edge so I can see how it was overlooked but at the minimum ILMN sequencing could have measured the heteroplasmies. Probably need UMIs to discount the cDNA syn error. Image
But now that the camel has its nose in the tent and has feasted on the money machine.. It will be back for more. Image
For those doubting my assessment of the mfg process, BASE spells it out here. Maybe my purity expectations are too high but I'd be anlot less scrupulous if Pfizer/Moderna put any raw sequence live for lot to lot QC. Zero for the vax. Millions for the virus. Image
This preprint monitors the translation fidelity in PseudoU and m1PseudoU.

biorxiv.org/content/10.110… ImageImageImage
Another one. I dont see an email address for this author.
jpands.org/vol27no2/hatfi…
One reason I don’t like the lemons into lemonade comment in this paper…
It speaks to sloppy translation perhaps being a good defense against variants.

That’s a very sloppy way to achieve a goal and may come with risks.
Consider this paper. RNA-Roulette

biorxiv.org/content/10.110…
If anyone has spare cycles, it would be helpful to calculate the Amino Acid edit distance of The vax Amino Acids to human amino acids in all 6 reading frames. This would give us a framework of the autoimmune risk of these synthesis errors.
The EMA leak has a lot to say about RNA integrity loss during manufacturing scale up.

If I had to guess,
Nucleotide purity probably played a role. It’s hard to scale up the synthesis of modified nucleotides and the polymerases don’t like to incorporate them. They stall. ImageImage
Particularly at long tracks of U.
PolyU incorporation it pure N1 methyl pseudoU could create polymerase stall points and truncated mRNA.

But RNA integrity numbers also include mRNAs that are too long so one can’t assume it’s only truncated mRNA.

childrenshealthdefense.org/defender/europ…

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Kevin McKernan

Kevin McKernan Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @Kevin_McKernan

Feb 7
The latest BS on @biorxivpreprint Image
This paper tries to makes claims of RT-qPCR sensitivity with a LLOQ of 372,800 molecules/ml as their lowest limit of Quantiation.

As a comparison, most clinical HIV RT-qPCR tests pick up 50 molecules/ml.
Hence they have very optimistic clearance rates.
biorxiv.org/content/10.648…
0.00085ng/ml is 372,800 copies. Image
Read 7 tweets
Jan 31
It is well known from BioNtech (Lenk et al) and Sutton et al (1997) that RNA:DNA hybrids inhibit DNaseI.

What is less known is that Quadruplex Gs also inhibit DNaseI. Some exist in SV40 and we get the most signal from this qPCR amplicon.

2 Different mechanisms of DNaseI inhibition = plasmid fragmentation cannot be assumed to be uniform in the mRNA vaccines. Hence 100 fold more spike than parts of the vector.

Below is a map of the codon optimized spike where Quadruplex Gs are overlaid with GAA repeats. GAA's are stickier RNA:DNA hybrids.

Our qPCR primers are overlayed as well.
@RetsefL @KUPERWASSERLAB @weldeiry @JesslovesMJK @DJSpeicher @TracyBethHoeg @DrJBhattacharyaImage
Evans et al demonstrate DNaseI is resistant to quadruplex Gs. They also move to alternative enzymes.
nature.com/articles/s4152…
This is from Lenk et al (BioNtech).
Note the concern over GAA sequences and RNA:DNA hybrids.
Our spike qPCR primers happen to land on GAA rich and quadruplex G rich regions of Spike.
frontiersin.org/journals/molec…Image
Read 4 tweets
Jan 30
@LocasaleLab I find the RNAi worship incongruent will how that entire field was ignored when injecting billions of people with mRNAs.
There are multiple 21bp homologies to human that emerged from the haphazard codon optimizations in the modRNA vaccine and no one cared?
@LocasaleLab Receipts.
Take Pfizers vax Sequence and run it through BLAT.
Hello... anyone from the RNAi space want to speak up about this? Image
ATGTTCGTGTTCCTGGTGCTGCTGCCTCTGGTGTCCAGCCAGTGTGTGAACCTGATCACCAGAACACAGTCATACACCAACAGCTTTACCAGAGGCGTGTACTACCCCGACAAGGTGTTCAGATCCAGCGTGCTGCACTCTACCCAGGACCTGTTCCTGCCTTTCTTCAGCAACGTGACCTGGTTCCACGCCATCTCCGGCACCAATGGCACCAAGAGATTCGACAACCCCGTGCTGCCCTTCAACGACGGGGTGTACTTTGCCAGCACCGAGAAGTCCAACATCATCAGAGGCTGGATCTTCGGCACCACACTGGACAGCAAGACCCAGAGCCTGCTGATCGTGAACAACGCCACCAACGTGGTCATCAAAGTGTGCGAGTTCCAGTTCTGCAACGACCCCTTCCTGGACGTCTACTACCACAAGAACAACAAGAGCTGGATGGAAAGCGAGTTCCGGGTGTACAGCAGCGCCAACAACTGCACCTTCGAGTACGTGTCCCAGCCTTTCCTGATGGACCTGGAAGGCAAGCAGGGCAACTTCAAGAACCTGCGCGAGTTCGTGTTTAAGAACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCTATCAACCTCGGCCGGGATCTGCCTCAGGGCTTCTCTGCTCTGGAACCCCTGGTGGATCTGCCCATCGGCATCAACATCACCCGGTTTCAGACACTGCTGGCCCTGCACAGAAGCTACCTGACACCTGGCGATAGCAGCAGCGGATGGACAGCTGGTGCCGCCGCTTACTATGTGGGCTACCTGCAGCCTAGAACCTTCCTGCTGAAGTACAACGAGAACGGCACCATCACCGACGCCGTGGATTGTGCTCTGGATCCTCTGAGCGAGACAAAGTGCACCCTGAAGTCCTTCACCGTGGAAAAGGGCATCTACCAGACCAGCAACTTCCGGGTGCAGCCCACCGAATCCATCGTGCGGTTCCCCAATATCACCAATCTGTGCCCCTTCGACGAGGTGTTCAATGCCACCAGATTCGCCTCTGTGTACGCCTGGAACCGGAAGCGGATCAGCAATTGCGTGGCCGACTACTCCGTGCTGTACAACTTCGCCCCCTTCTTCGCATTCAAGTGCTACGGCGTGTCCCCTACCAAGCTGAACGACCTGTGCTTCACAAACGTGTACGCCGACAGCTTCGTGATCCGGGGAAACGAAGTGCGGCAGATTGCCCCTGGACAGACAGGCAACATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGTGTGATTGCCTGGAACAGCAACAAGCTGGACTCCAAAGTCGGCGGCAACTACAATTACAGGTACCGGCTGTTCCGGAAGTCCAATCTGAAGCCCTTCGAGCGGGACATCTCCACCGAGATCTATCAGGCCGGCAACAAGCCTTGTAACGGCGTGGCAGGCGTGAACTGCTACTTCCCACTGCAGTCCTACGGCTTTAGGCCCACATACGGCGTGGGCCACCAGCCCTACAGAGTGGTGGTGCTGAGCTTCGAACTGCTGCATGCCCCTGCCACAGTGTGCGGCCCTAAGAAAAGCACCAATCTCGTGAAGAACAAATGCGTGAACTTCAACTTCAACGGCCTGACCGGCACCGGCGTGCTGACAGAGAGCAACAAGAAGTTCCTGCCATTCCAGCAGTTTGGCCGGGATATCGCCGATACCACAGACGCCGTTAGAGATCCCCAGACACTGGAAATCCTGGACATCACCCCTTGCAGCTTCGGCGGAGTGTCTGTGATCACCCCTGGCACCAACACCAGCAATCAGGTGGCAGTGCTGTACCAGGGCGTGAACTGTACCGAAGTGCCCGTGGCCATTCACGCCGATCAGCTGACACCTACATGGCGGGTGTACTCCACCGGCAGCAATGTGTTTCAGACCAGAGCCGGCTGTCTGATCGGAGCCGAGTACGTGAACAATAGCTACGAGTGCGACATCCCCATCGGCGCTGGAATCTGCGCCAGCTACCAGACACAGACAAAGAGCCACCGGAGAGCCAGAAGCGTGGCCAGCCAGAGCATCATTGCCTACACAATGTCTCTGGGCGCCGAGAACAGCGTGGCCTACTCCAACAACTCTATCGCTATCCCCACCAACTTCACCATCAGCGTGACCACAGAGATCCTGCCTGTGTCCATGACCAAGACCAGCGTGGACTGCACCATGTACATCTGCGGCGATTCCACCGAGTGCTCCAACCTGCTGCTGCAGTACGGCAGCTTCTGCACCCAGCTGAAAAGAGCCCTGACAGGGATCGCCGTGGAACAGGACAAGAACACCCAAGAGGTGTTCGCCCAAGTGAAGCAGATCTACAAGACCCCTCCTATCAAGTACTTCGGCGGCTTCAATTTCAGCCAGATTCTGCCCGATCCTAGCAAGCCCAGCAAGCGGAGCTTCATCGAGGACCTGCTGTTCAACAAAGTGACACTGGCCGACGCCGGCTTCATCAAGCAGTATGGCGATTGTCTGGGCGACATTGCCGCCAGGGATCTGATTTGCGCCCAGAAGTTTAACGGACTGACAGTGCTGCCTCCTCTGCTGACCGATGAGATGATCGCCCAGTACACATCTGCCCTGCTGGCCGGCACAATCACAAGCGGCTGGACATTTGGAGCAGGCGCCGCTCTGCAGATCCCCTTTGCTATGCAGATGGCCTACCGGTTCAACGGCATCGGAGTGACCCAGAATGTGCTGTACGAGAACCAGAAGCTGATCGCCAACCAGTTCAACAGCGCCATCGGCAAGATCCAGGACAGCCTGAGCAGCACAGCAAGCGCCCTGGGAAAGCTGCAGGACGTGGTCAACCACAATGCCCAGGCACTGAACACCCTGGTCAAGCAGCTGTCCTCCAAGTTCGGCGCCATCAGCTCTGTGCTGAACGATATCCTGAGCAGACTGGACCCTCCTGAGGCCGAGGTGCAGATCGACAGACTGATCACAGGCAGACTGCAGAGCCTCCAGACATACGTGACCCAGCAGCTGATCAGAGCCGCCGAGATTAGAGCCTCTGCCAATCTGGCCGCCACCAAGATGTCTGAGTGTGTGCTGGGCCAGAGCAAGAGAGTGGACTTTTGCGGCAAGGGCTACCACCTGATGAGCTTCCCTCAGTCTGCCCCTCACGGCGTGGTGTTTCTGCACGTGACATATGTGCCCGCTCAAGAGAAGAATTTCACCACCGCTCCAGCCATCTGCCACGACGGCAAAGCCCACTTTCCTAGAGAAGGCGTGTTCGTGTCCAACGGCACCCATTGGTTCGTGACACAGCGGAACTTCTACGAGCCCCAGATCATCACCACCGACAACACCTTCGTGTCTGGCAACTGCGACGTCGTGATCGGCATTGTGAACAATACCGTGTACGACCCTCTGCAGCCCGAGCTGGACAGCTTCAAAGAGGAACTGGACAAGTACTTTAAGAACCACACAAGCCCCGACGTGGACCTGGGCGATATCAGCGGAATCAATGCCAGCGTCGTGAACATCCAGAAAGAGATCGACCGGCTGAACGAGGTGGCCAAGAATCTGAACGAGAGCCTGATCGACCTGCAAGAACTGGGGAAGTACGAGCAGTACATCAAGTGGCCCTGGTACATCTGGCTGGGCTTTATCGCCGGACTGATTGCCATCGTGATGGTCACAATCATGCTGTGTTGCATGACCAGCTGCTGTAGCTGCCTGAAGGGCTGTTGTAGCTGTGGCAGCTGCTGCAAGTTCGACGAGGACGATTCTGAGCCCGTGCTGAAGGGCGTGAAACTGCACTACACATGATGA
Read 8 tweets
Jan 19
On Veterans Day @CharlesRixey @JesslovesMJK
Stopped by MGC.

2 long days later we had all of his data.

It’s now published in The Journal of Independent Medicine.

It describes the mechanism of failure for the DNA contamination in the mRNA shots and why the regulators are missing it.
@JesslovesMJK @CharlesRixey @weldeiry @KUPERWASSERLAB @RetsefL @DrJBhattacharya @RWMaloneMD @RobertKennedyJr @TracyBethHoegImage
Image
Image
Image
Image
Read 5 tweets
Dec 19, 2025
Another Achs et al Fumble uncovered.
These folks don't even understand Capillary Electrophoresis.

Its becoming increasingly clear these are not honest mistakes but designed to deceive by people who are employed at a Vaccine Research Institute.
Science for Sale.

@JesslovesMJK @DJSpeicherImage
Here is the Rub.
They used a CE instrument that has a lower limit of sensitivity above the 10ng limit.
You need to be able to pick up 10X below the 10ng limit. Or 33pg/ul (300ul dose @ 10ng = 33pg/ul) Image
This is embarrassingly rigged or they are incompetent.
They ignored our comments on the preprint server and raced their paper into @Nature.

@JesslovesMJK and @DJSpeicher have their own substacks picking up other errors in this paper I'll post sortly. Image
Read 5 tweets
Dec 15, 2025
Image
Image
Note, its unique to that wonderful Furin Cleavage site. Image
Read 4 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Don't want to be a Premium member but still want to support us?

Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal

Or Donate anonymously using crypto!

Ethereum

0xfe58350B80634f60Fa6Dc149a72b4DFbc17D341E copy

Bitcoin

3ATGMxNzCUFzxpMCHL5sWSt4DVtS8UqXpi copy

Thank you for your support!

Follow Us!

:(