From FOI 3471 the requested primer sequences and Batch analysis of FK8917 (which no longer appears on the TGA's website) were rejected, but they did provide batch analysis of the other batches requested - of which two (of 4) appear on the "death batch" list.
What are the odds?
BUT - in the 57 documents there was something that stuck out and which I posted about earlier in the year.
Because this account was suspended, that information was hidden from the public.
▶️The Agilent curve showed irregularities in the RNA analysis that was ignored by the TGA.
Here they are. Note the batch numbers
FL5333, FH3221, FK0738 and FL7649 - all death batches.
To illustrate what I'm talking about I've put a big red arrow on the point of interest. Subtle eh?
Now that hump (at about 3000nt) shouldn't be there. There is a smaller one at about 2000nt.
That agilent analysis (which should show a spike at the size of RNA of interest) shows RNA contamination.
There is RNA there that shouldn't be there
To illustrate the point further there ARE batches that don't have these humps. This is what an Agilent analysis of a relatively pure RNA should look like.
A nice smooth transition from the main spike. No humps.
These batches are not in the death log.
Do you know what else is not in the death batch log?
Any of the 7 batches reserved for Pfizer employees.
No, I'm not kidding:
FF0884
FA4598
FE3064
FA7338
FA7812
FC8736
FC3558
So, on the information that we have available (which is restricted) we must conclude that the contaminated batches lead to deaths which were not investigated and the contamination was ignored.
Of course, the TGA can tell you that they "didn't know" that these agilent curves showed contamination.
You know why?
Because they didn't know how to handle genetically transferable material. The very definition that should have meant referral to the OGTR.
And you know what else the TGA (and equally the FDA, MHRA and EMA) didn't know about this novel gene technlology?
Everything.
We asked them.
They had (and have) no idea what they were dealing with.
They just approved it because someone told them to.
And people died.
Just a note of thanks to the helper mice that have bravely put themselves out to make these requests.
You know who you are.
I should just add this extra bombshell from a few days ago here...
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.
It's like Georgia. Someone flood the polling station quick!
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.
The problem is that they now have 19 hours to keep the bots going.
@elonmusk please make poll voting a 2-step interaction. TY.