Jikkyleaks 🐭 Profile picture
Dec 27, 2022 19 tweets 8 min read Read on X
HOLY CHEESE 🧀🧀🧀
I have discovered something that should lead to the immediate investigation of the TGA and every drug regulator

Two FOIs prove that there were batches of #Pfizer vaccine that had killed people and should have failed the batch analysis.

But they kept jabbing. Image
You don't need a science degree or a molecular biology PhD for this. You just need an eye for patterns. Here is FOI 4077 just released.

Each row is a person who died. They died because they believed the TGA ATAGI MHRA JCVI FDA mantra of "safe and effective", which was not true ImageImage
In the report, which is only a fraction of the 900+ deaths reported to the TGA, only a few batch numbers are documented.

Here is the document (it's been archived)
tga.gov.au/sites/default/…
So any batch number that appears more than once is a red flag. The obvious ones are FL5333, FH3221 and 000062A.

What are the odds that those batch numbers appear in a freedom of information request put in on the 6th December 2021, which was partially rejected? Image
For context, there are 382 batches on the TGA's batch analysis report.

tga.gov.au/batch-release-…
From FOI 3471 the requested primer sequences and Batch analysis of FK8917 (which no longer appears on the TGA's website) were rejected, but they did provide batch analysis of the other batches requested - of which two (of 4) appear on the "death batch" list.

What are the odds? Image
BUT - in the 57 documents there was something that stuck out and which I posted about earlier in the year.

Because this account was suspended, that information was hidden from the public.
This goes all the way back to April or before.
So this is the bombshell.

▶️The Agilent curve showed irregularities in the RNA analysis that was ignored by the TGA.

Here they are. Note the batch numbers
FL5333, FH3221, FK0738 and FL7649 - all death batches. ImageImageImageImage
To illustrate what I'm talking about I've put a big red arrow on the point of interest. Subtle eh? ImageImage
Now that hump (at about 3000nt) shouldn't be there. There is a smaller one at about 2000nt.

That agilent analysis (which should show a spike at the size of RNA of interest) shows RNA contamination.

There is RNA there that shouldn't be there
To illustrate the point further there ARE batches that don't have these humps. This is what an Agilent analysis of a relatively pure RNA should look like.

A nice smooth transition from the main spike. No humps.

These batches are not in the death log. ImageImageImage
Do you know what else is not in the death batch log?

Any of the 7 batches reserved for Pfizer employees.

No, I'm not kidding:
FF0884
FA4598
FE3064
FA7338
FA7812
FC8736
FC3558

tga.gov.au/batch-release-… Image
So, on the information that we have available (which is restricted) we must conclude that the contaminated batches lead to deaths which were not investigated and the contamination was ignored.
Of course, the TGA can tell you that they "didn't know" that these agilent curves showed contamination.

You know why?

Because they didn't know how to handle genetically transferable material. The very definition that should have meant referral to the OGTR. Image
And you know what else the TGA (and equally the FDA, MHRA and EMA) didn't know about this novel gene technlology?

Everything.
We asked them.
They had (and have) no idea what they were dealing with.
They just approved it because someone told them to.
And people died. Image
Just a note of thanks to the helper mice that have bravely put themselves out to make these requests.

You know who you are.
I should just add this extra bombshell from a few days ago here...

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Jikkyleaks 🐭

Jikkyleaks 🐭 Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @Jikkyleaks

Nov 10
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 No. They have not monitored them. We have an FOI on this
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 TGA FOI 5274. Refused.
(part 1 of 2).

The TGA has no idea how many miscarriages occurred after COVID vaccination because they had no interest.

Their only interest is in protecting their income stream and the Bollinger.

@SenatorRennick @DrJulieSladden @BroadbentMP Image
Image
Image
Image
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 @SenatorRennick @DrJulieSladden @BroadbentMP TGA FOI 5274. Refused.
(part 2 of 2).

No pharmacovigilance was performed.
The TGA lied.

#placentagate Image
Image
Image
Read 5 tweets
Nov 7
Are you looking for this @VaccineMole ?

Declared "BGH polyA" sequence (226bp): CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTG
CCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTAT
TCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGAT
GCGGTGGGCTCTATGG

Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC

So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...

jbc.org/article/S0021-…

I'll try and find the missing sequence
#SV40Gate #PlasmidGateImage
Image
@Kevin_McKernan @VaccineMole Add in a CMV promoter for good measure and perhaps a soupcon of cancer to boot.

THIS IS WHY YOU DO NOT PUT PLASMIDS INTO LIPID NANOPARTICLES AND TRANSFECT THEM INTO HUMANS.
pmc.ncbi.nlm.nih.gov/articles/PMC26…

x.com/Jikkyleaks/sta…
Here it is.
The Oxford plasmid.
"SpyTag" and "SnoopTag" and a CMV promoter with the moo cow equivalent of SV40 in the PolyA.

I'm sure it's just a coincidence.

#TagGate
@FeeRedfern @JesslovesMJK @double_christ
ncbi.nlm.nih.gov/nucleotide/KU3…
ncbi.nlm.nih.gov/nucleotide/KY9…
pubmed.ncbi.nlm.nih.gov/26781591/Image
Image
Read 7 tweets
Aug 10
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
@DiedSuddenly_ Addendum: Some undeclared replication of images from the Jeon paper in 2022, same journal.
Jeon (left):
Lee (right):


@JesslovesMJK @Kevin_McKernan
#NanoGate ijvtpr.com/index.php/IJVT…
mail.ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄

#NanoGate Image
Read 4 tweets
Aug 10
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag

My view reading this is:

This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.

I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.Image
Image
Image
Image
@DiedSuddenly_ A bowling alley?

I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.

This was from 2022:


I wonder if they targeted Broudy to add some credence to the LARP. ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
Read 4 tweets
Jun 16
@SenatorRennick The #3tablets protocols and #midazolam murders were the primary drivers of "COVID" death prior to the GMO rollout.

The publishers, who remain nameless, should be called to give evidence.covid19evidence.net.au
What in the holy hell?

The website which was used to propagandise the treatment of COVID during 2020-2024, and withhold effective treatments from people who then died..

Is now an air freight site.

THIS IS WHY WE ARCHIVE.

@tonynikolic10 @BroadbentMPcovid19evidence.net.auImage
https://archive.is/dEBZ1
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.

It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law
archive.is/dEBZ1
Read 4 tweets
Jan 25
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.

It's like Georgia. Someone flood the polling station quick! Image
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.

The problem is that they now have 19 hours to keep the bots going.

@elonmusk please make poll voting a 2-step interaction. TY.
Image
Image
Read 9 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Don't want to be a Premium member but still want to support us?

Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal

Or Donate anonymously using crypto!

Ethereum

0xfe58350B80634f60Fa6Dc149a72b4DFbc17D341E copy

Bitcoin

3ATGMxNzCUFzxpMCHL5sWSt4DVtS8UqXpi copy

Thank you for your support!

Follow Us!

:(