The source document sent to me appears to be from those released under @AaronSiriSG@IamBrookJackson legal actions to investigate fraud in the Pfizer vaccine study that the FDA said they needed 75 years to release the documents.
Yet they assessed the 450,000 pages in 24 hours?
I'll say that again.
There were 11 MILLION total documents (44,000 patients, minimum 250 pages per patient plus 350,000 assessment and summary documents).
The FDA was given the glossy summary on the 10th December.
The vaccine was "approved" on the 11th December.
The committee meeting is still online - 8 hours long.
The whole day was used for the meeting.
The drug was approved the next day.
Give me a break.
These images should have been enough to prompt an investigation but nobody cared.
The deal was already done.
The VRBPAC committee meeting was Kabuki theatre.
Just a reminder as to what this is about - this is what a normal (and technically relatively clean) Western blot might look like - from the EMA official analysis. Note that this image has severe dithering artefact close-up. None of that malarkey for our pfraud-convicted pfriends!
And more examples of real Westerns in the thread here
So we now have evidence of:
▶️Extra mRNA in the product that has never been analysed by sequencing.
▶️Fabricated protein analysis
▶️Rubber stamp approval with NO ASSESSMENT
The TGA & MHRA copied the FDA and did not perform any independent assessment.
@SECGov @Kevin_McKernan @SabinehazanMD Wow so this company is claiming influence with 11,000 scientists and multiple links lead back to pharma and the gene therapy corporations.
Broad institute. Who could have guessed?
#pubpeergate
@Yale could be up to their necks in the biggest HIPAA scandal since @UChicago
This is how the scam appears to have worked.
Harlan Krumholz owns a patent for managing health data through an app. "Hugo health" was the middle man providing the app to bait people claiming to be vaccine injured to join a study called LISTEN. But it was essentially being run on behalf of Pfizer/Janssen who paid him $3m in "research grants".
Thousands of injured signed up but only 241 patients were used in the "study" of which the publications were irrelevant and showed nothing other than "the vaccines saved millions of lives" bla bla. Nothing helpful for the vaccine injured at all.
But the bombshell - the data that they provided was able to be sold off to anyone they wanted to. It was in the consent form that most people didn't read. The data was held on hugo.health which has now gone. It was NOT HIPAA compliant.
How did we know that hugo.health's servers were not HIPAA compliant?
Yale told the participants in a email in July 2024 (attached).
So where did all that health data go?
Was it sold off to the highest bidder or used in a blackmail campaign against vulnerable people who were vaccine injured and couldn't work? (Like those that have targeted our accounts recently)
We don't know. But you can be damn sure that Yale knows, and took secret action to remedy the situation having already taken millions of dollars from pharma to run studies that undermined the vaccine injured.
That is why there is so much animosity suddenly being directed at the vaccine injured. They want to bury this story.
Yale could be in very big trouble.
They deserve a hashtag.
#YaleGate
@Yale @UChicago For those confused, please understand what a "limited hangout" is here. While you are rejoicing on the scraps of Daily Mail fodder, the pharma companies' new narrative is enshrined by those very articles.
@jsm2334 I have 3 new questions:
1⃣ why didn't you appear on the Razzaghi paper using your data?
2⃣ is your data synthetic?
3⃣ what is the binomial probability that 18/20 of a university's research team come from a group that comprises 2% of the US population, if all groups are equal?
@jsm2334 For those confused... The original thread on #OHDSI - the data curators claiming an impossible 96% efficacy rate for a type-mismatched vaccine against infection - is here.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...