The source document sent to me appears to be from those released under @AaronSiriSG@IamBrookJackson legal actions to investigate fraud in the Pfizer vaccine study that the FDA said they needed 75 years to release the documents.
Yet they assessed the 450,000 pages in 24 hours?
I'll say that again.
There were 11 MILLION total documents (44,000 patients, minimum 250 pages per patient plus 350,000 assessment and summary documents).
The FDA was given the glossy summary on the 10th December.
The vaccine was "approved" on the 11th December.
The committee meeting is still online - 8 hours long.
The whole day was used for the meeting.
The drug was approved the next day.
Give me a break.
These images should have been enough to prompt an investigation but nobody cared.
The deal was already done.
The VRBPAC committee meeting was Kabuki theatre.
Just a reminder as to what this is about - this is what a normal (and technically relatively clean) Western blot might look like - from the EMA official analysis. Note that this image has severe dithering artefact close-up. None of that malarkey for our pfraud-convicted pfriends!
And more examples of real Westerns in the thread here
So we now have evidence of:
▶️Extra mRNA in the product that has never been analysed by sequencing.
▶️Fabricated protein analysis
▶️Rubber stamp approval with NO ASSESSMENT
The TGA & MHRA copied the FDA and did not perform any independent assessment.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.
It's like Georgia. Someone flood the polling station quick!
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.
The problem is that they now have 19 hours to keep the bots going.
@elonmusk please make poll voting a 2-step interaction. TY.