Can anyone explain how all-cause mortality in the UK in April 2020 spiked at exactly the same time in every region when travel routes into the UK are overwhelmingly via the South East?
Travel is undertaken by only a fraction of the population at any one time, so the idea that "COVID" could be spread by travel as explanation of this sporadic pattern of worldwide spread seems unlikely.
It should spread locally - predominantly.
Yet there was basically no increase in all-cause mortality outside of Wuhan in mainland China for 2 years.
Which means that the only logical explanation is that the MERS outbreaks - which were "not natural" - were the model for the transmitting "COVID" to the world in such an unnatural manner. pubmed.ncbi.nlm.nih.gov/32288979/
The remaining question should be: how could this be obtained with a coronavirus, which can't survive in the water supply or the food supply or in UV light? healthline.com/health/does-uv…
One answer is an infectious clone or vector. Just like the Astrazeneca "vaccine" - you can put a virus into another organism and the other organism can express the virus
The supervising author is Pei-Yong Shi of the UTMB who is (1) affiliated to the PLA-CCP (2) the head of the lab that produced the "neutralising antibody" studies for the Pfizer "vaccine".
No, I'm not kidding.
Here are Pei-Yong Shi's academic networks.
Pfizer.
Novartis.
Gilead.
Chinese Academy of Sciences (PLA-CCP)
@jsm2334 I have 3 new questions:
1⃣ why didn't you appear on the Razzaghi paper using your data?
2⃣ is your data synthetic?
3⃣ what is the binomial probability that 18/20 of a university's research team come from a group that comprises 2% of the US population, if all groups are equal?
@jsm2334 For those confused... The original thread on #OHDSI - the data curators claiming an impossible 96% efficacy rate for a type-mismatched vaccine against infection - is here.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1