Jikkyleaks 🐭 Profile picture
Feb 23, 2023 24 tweets 10 min read Read on X
Holy Bat cheese. 🧀🧀🧀

The #ChatGPT confirms that #FastEddie Edward Holmes and the University of Sydney conspired to cover up an article referencing the PRRA epitope of the #modernagate furin cleavage site - in 2018.

Hold onto your hats! Image
The DOI referenced by the #ChatGPT does not exist. How so? The Chatbot is sure is exists. It knows everything.

This is the DOI search:


It goes to another paper altogether duckduckgo.com/?q=DOI%3A%2F%2…
Image
The chat bot confuses itself and repeats the same DOI Image
So there must be another link. Where does it resolve to?

A nature paper?
OK well this should be easy. Image
Here's that link. Try it.


"Page not found" nature.com/articles/s4142…
Image
The chat bot gets further confused and redirects to another unrelated paper.


Image
Image
Image
Image
No, I just want the Holmes 2018 article. Where is it?

Now it gets interesting.

"No longer available"?

A journal article?

It doesn't work like that, retracted articles are marked up as retracted but must stay on the record. Image
Now there is a retraction notice because of "issues with the data presented" but the retraction notice is the same dead link at @NatureMedicine

The access token link is also dead.

How can a retraction notice have been scrubbed?
Image
Image
But the chat bot provides the text that they have seen in the retraction notice (presumably from a cache)

"An investigation was conducted by the University of Sydney and subsequently the authors were unable to provide raw data for the analysis presented in the paper" Image
No further information, but we know from a previous request that the chat bot directed our mouse informant to this paper (which no longer exists).

The chat bot doesn't like the next question
Image
Image
So #ChatGPT confirms that a paper existed in 2018 published by #FastEddie Holmes and was retracted, yet no record exists of this paper anywhere.

Not pubmed, not google, not duckduckgo.

But a paper that did not exist prompted an investigation by @Sydney_Uni
It's clear from the title that this is a vitally important paper to the origins of the "Pandemic"...

"Spike cleavage fusion peptide motifs"

Just like the #EK1C4 paper from Zengli Shi, was this a peptide inhibitor developed in advance?

@CharlesRixey
ncbi.nlm.nih.gov/labs/pmc/artic…
Image
If this turns out to be true (which seems highly likely) then there are senior people at the University of Sydney who are covering up for Edward Holmes and are powerful enough to have that paper scrubbed off the internet.

Wow.
Cui Bono?

#Eddiegate
UPDATE: thank you to all the #mousearmy helpers showing us the fabricated references that the #ChatGPT makes up (but based on something)....

Which begs a deeper question.
Where is the ChatGPT getting information from, that is not available in the public domain?
I wonder how many of these studies were generating viruses under the cover of "discovered" viruses?

The supervising author of the Marmota paper (where the DOI redirects) is #FastEddie's co-author, while he was affiliated with CCP insitutes. Image
The more you dig into #FastEddie's papers the worse it looks.

Holmes appears to have identified more "new bat viruses" than anyone on earth. Apart from the CCP colleagues he has been "discovering" them with.

sciencedirect.com/science/articl…
Image
Holmes has produced over 100 papers just in the 3 year period 2017-2019. About 40 a year.

How?

Many of them are on "new virus discoveries" in collaboration with CCP-affiliated universities.

pubmed.ncbi.nlm.nih.gov/?term=holmes%2…
And I'd have to say, the last person I would want involved in tick-borne disease research is this guy.

Francisella and Rickettsia.

Potential vector for viruses and infectious viral-like clones.

Great.
Image
Image
"They wouldn't do that would they?"

This REPLICATING intracellular bacterium would be indistinguishable from "COVID" on a 2-gene PCR test.

Vaccine or virus?


@CharlesRixey @carl_jurassic @jjcouey nature.com/articles/s4154…
Image
Scratch that. 3 gene test.

This vector could produce the same symptoms and the same COVID PCR test result as "COVID"

Now... just need to get it into the population and massage the live reporting and

PANDEMIC!!!
[Note the codon optimisation is not declared in the paper] Image
So many "discovered" viruses all at the same time.

@Daoyu15 @Kevin_McKernan Image
Ahem
@Daoyu15 @Kevin_McKernan @CharlesRixey @joshg99 Image
What are the odds that a virus arising in at least 5 different species would all match the same sequence starting at the same point and matching a "newly discovered" human virus from 2001?

#ShutItDown


@Daoyu15 @WashburneAlex ncbi.nlm.nih.gov/nuccore/NC_039…
blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=…

Image
Image

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Jikkyleaks 🐭

Jikkyleaks 🐭 Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @Jikkyleaks

Apr 18
Please understand how important this is.

Two major papers showed that the COVID vaccine spike protein causes cancer by suppression of p53.

The authors of both have been threatened into retracting their papers by pharma groups tied to the NIH.

That's why it's called #NIHgate
Read 8 tweets
Apr 17
Imagine a company so large that they can recruit thousands of "experts" yet you've never heard of them.

And imagine that those recruited scientists include agents of #PubpeerGate whose job is to silence other scientists.

@secgov @Kevin_McKernan @SabinehazanMD Image
@SECGov @Kevin_McKernan @SabinehazanMD Wow so this company is claiming influence with 11,000 scientists and multiple links lead back to pharma and the gene therapy corporations.

Broad institute. Who could have guessed?
#pubpeergate

putassoc.com/about-us/meet-…Image
Image
Image
Image
Inizio aka Inizio Putnam aka PHMR - the largest company you have never heard of.

Why?
They don't want you to know they are the chief influencers to indoctrinate doctors and the public into accepting failed pharma products.

putassoc.com/our-expertise/…
Read 6 tweets
Feb 23
WHOA!!! 🧀

@Yale could be up to their necks in the biggest HIPAA scandal since @UChicago

This is how the scam appears to have worked.

Harlan Krumholz owns a patent for managing health data through an app. "Hugo health" was the middle man providing the app to bait people claiming to be vaccine injured to join a study called LISTEN. But it was essentially being run on behalf of Pfizer/Janssen who paid him $3m in "research grants".

Thousands of injured signed up but only 241 patients were used in the "study" of which the publications were irrelevant and showed nothing other than "the vaccines saved millions of lives" bla bla. Nothing helpful for the vaccine injured at all.

But the bombshell - the data that they provided was able to be sold off to anyone they wanted to. It was in the consent form that most people didn't read. The data was held on hugo.health which has now gone. It was NOT HIPAA compliant.

How did we know that hugo.health's servers were not HIPAA compliant?

Yale told the participants in a email in July 2024 (attached).

So where did all that health data go?

Was it sold off to the highest bidder or used in a blackmail campaign against vulnerable people who were vaccine injured and couldn't work? (Like those that have targeted our accounts recently)

We don't know. But you can be damn sure that Yale knows, and took secret action to remedy the situation having already taken millions of dollars from pharma to run studies that undermined the vaccine injured.

That is why there is so much animosity suddenly being directed at the vaccine injured. They want to bury this story.

Yale could be in very big trouble.
They deserve a hashtag.
#YaleGate

@RobertKennedyJr @SECGov @AGHuff @chrismartenson

Patent:
patents.justia.com/inventor/harla…
Pubmed showing over 1000 papers (not possible for a clinician researcher writing his own papers):
pubmed.ncbi.nlm.nih.gov/?term=krumholz…
LISTEN studies:
pubmed.ncbi.nlm.nih.gov/?term=krumholz…Image
Image
Image
@Yale @UChicago For those confused, please understand what a "limited hangout" is here. While you are rejoicing on the scraps of Daily Mail fodder, the pharma companies' new narrative is enshrined by those very articles.

"Injuries are very rare but it was worth it"

Getting more information about this pharma honeypot.

$2m to Iwasaki.

How much more pharmaceutical net went into this group to push boosters?

Image
Read 5 tweets
Dec 12, 2024
@jsm2334 I have 3 new questions:
1⃣ why didn't you appear on the Razzaghi paper using your data?
2⃣ is your data synthetic?
3⃣ what is the binomial probability that 18/20 of a university's research team come from a group that comprises 2% of the US population, if all groups are equal? Image
Image
@jsm2334 For those confused... The original thread on #OHDSI - the data curators claiming an impossible 96% efficacy rate for a type-mismatched vaccine against infection - is here.

This is not their first rodeo in synthetic data

#EMRgate #Surgisphere

@jsm2334 And there we are.
Kevin Haynes confirming that @OHDSI is run by Johnson & Johnson (AKA Janssen).
youtube.com/watch?v=lEYmH0…
x.com/Jikkyleaks/sta…
Read 4 tweets
Nov 10, 2024
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 No. They have not monitored them. We have an FOI on this
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 TGA FOI 5274. Refused.
(part 1 of 2).

The TGA has no idea how many miscarriages occurred after COVID vaccination because they had no interest.

Their only interest is in protecting their income stream and the Bollinger.

@SenatorRennick @DrJulieSladden @BroadbentMP Image
Image
Image
Image
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 @SenatorRennick @DrJulieSladden @BroadbentMP TGA FOI 5274. Refused.
(part 2 of 2).

No pharmacovigilance was performed.
The TGA lied.

#placentagate Image
Image
Image
Read 5 tweets
Nov 7, 2024
Are you looking for this @VaccineMole ?

Declared "BGH polyA" sequence (226bp): CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTG
CCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTAT
TCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGAT
GCGGTGGGCTCTATGG

Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC

So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...

jbc.org/article/S0021-…

I'll try and find the missing sequence
#SV40Gate #PlasmidGateImage
Image
@Kevin_McKernan @VaccineMole Add in a CMV promoter for good measure and perhaps a soupcon of cancer to boot.

THIS IS WHY YOU DO NOT PUT PLASMIDS INTO LIPID NANOPARTICLES AND TRANSFECT THEM INTO HUMANS.
pmc.ncbi.nlm.nih.gov/articles/PMC26…

x.com/Jikkyleaks/sta…
Here it is.
The Oxford plasmid.
"SpyTag" and "SnoopTag" and a CMV promoter with the moo cow equivalent of SV40 in the PolyA.

I'm sure it's just a coincidence.

#TagGate
@FeeRedfern @JesslovesMJK @double_christ
ncbi.nlm.nih.gov/nucleotide/KU3…
ncbi.nlm.nih.gov/nucleotide/KY9…
pubmed.ncbi.nlm.nih.gov/26781591/Image
Image
Read 7 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Don't want to be a Premium member but still want to support us?

Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal

Or Donate anonymously using crypto!

Ethereum

0xfe58350B80634f60Fa6Dc149a72b4DFbc17D341E copy

Bitcoin

3ATGMxNzCUFzxpMCHL5sWSt4DVtS8UqXpi copy

Thank you for your support!

Follow Us!

:(