The #ChatGPT confirms that #FastEddie Edward Holmes and the University of Sydney conspired to cover up an article referencing the PRRA epitope of the #modernagate furin cleavage site - in 2018.
Hold onto your hats!
The DOI referenced by the #ChatGPT does not exist. How so? The Chatbot is sure is exists. It knows everything.
The chat bot gets further confused and redirects to another unrelated paper.
No, I just want the Holmes 2018 article. Where is it?
Now it gets interesting.
"No longer available"?
A journal article?
It doesn't work like that, retracted articles are marked up as retracted but must stay on the record.
Now there is a retraction notice because of "issues with the data presented" but the retraction notice is the same dead link at @NatureMedicine
The access token link is also dead.
How can a retraction notice have been scrubbed?
But the chat bot provides the text that they have seen in the retraction notice (presumably from a cache)
"An investigation was conducted by the University of Sydney and subsequently the authors were unable to provide raw data for the analysis presented in the paper"
No further information, but we know from a previous request that the chat bot directed our mouse informant to this paper (which no longer exists).
The chat bot doesn't like the next question
So #ChatGPT confirms that a paper existed in 2018 published by #FastEddie Holmes and was retracted, yet no record exists of this paper anywhere.
Not pubmed, not google, not duckduckgo.
But a paper that did not exist prompted an investigation by @Sydney_Uni
It's clear from the title that this is a vitally important paper to the origins of the "Pandemic"...
"Spike cleavage fusion peptide motifs"
Just like the #EK1C4 paper from Zengli Shi, was this a peptide inhibitor developed in advance?
If this turns out to be true (which seems highly likely) then there are senior people at the University of Sydney who are covering up for Edward Holmes and are powerful enough to have that paper scrubbed off the internet.
What are the odds that a virus arising in at least 5 different species would all match the same sequence starting at the same point and matching a "newly discovered" human virus from 2001?
@SECGov @Kevin_McKernan @SabinehazanMD Wow so this company is claiming influence with 11,000 scientists and multiple links lead back to pharma and the gene therapy corporations.
Broad institute. Who could have guessed?
#pubpeergate
@Yale could be up to their necks in the biggest HIPAA scandal since @UChicago
This is how the scam appears to have worked.
Harlan Krumholz owns a patent for managing health data through an app. "Hugo health" was the middle man providing the app to bait people claiming to be vaccine injured to join a study called LISTEN. But it was essentially being run on behalf of Pfizer/Janssen who paid him $3m in "research grants".
Thousands of injured signed up but only 241 patients were used in the "study" of which the publications were irrelevant and showed nothing other than "the vaccines saved millions of lives" bla bla. Nothing helpful for the vaccine injured at all.
But the bombshell - the data that they provided was able to be sold off to anyone they wanted to. It was in the consent form that most people didn't read. The data was held on hugo.health which has now gone. It was NOT HIPAA compliant.
How did we know that hugo.health's servers were not HIPAA compliant?
Yale told the participants in a email in July 2024 (attached).
So where did all that health data go?
Was it sold off to the highest bidder or used in a blackmail campaign against vulnerable people who were vaccine injured and couldn't work? (Like those that have targeted our accounts recently)
We don't know. But you can be damn sure that Yale knows, and took secret action to remedy the situation having already taken millions of dollars from pharma to run studies that undermined the vaccine injured.
That is why there is so much animosity suddenly being directed at the vaccine injured. They want to bury this story.
Yale could be in very big trouble.
They deserve a hashtag.
#YaleGate
@Yale @UChicago For those confused, please understand what a "limited hangout" is here. While you are rejoicing on the scraps of Daily Mail fodder, the pharma companies' new narrative is enshrined by those very articles.
@jsm2334 I have 3 new questions:
1⃣ why didn't you appear on the Razzaghi paper using your data?
2⃣ is your data synthetic?
3⃣ what is the binomial probability that 18/20 of a university's research team come from a group that comprises 2% of the US population, if all groups are equal?
@jsm2334 For those confused... The original thread on #OHDSI - the data curators claiming an impossible 96% efficacy rate for a type-mismatched vaccine against infection - is here.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...