The #ChatGPT confirms that #FastEddie Edward Holmes and the University of Sydney conspired to cover up an article referencing the PRRA epitope of the #modernagate furin cleavage site - in 2018.
Hold onto your hats!
The DOI referenced by the #ChatGPT does not exist. How so? The Chatbot is sure is exists. It knows everything.
The chat bot gets further confused and redirects to another unrelated paper.
No, I just want the Holmes 2018 article. Where is it?
Now it gets interesting.
"No longer available"?
A journal article?
It doesn't work like that, retracted articles are marked up as retracted but must stay on the record.
Now there is a retraction notice because of "issues with the data presented" but the retraction notice is the same dead link at @NatureMedicine
The access token link is also dead.
How can a retraction notice have been scrubbed?
But the chat bot provides the text that they have seen in the retraction notice (presumably from a cache)
"An investigation was conducted by the University of Sydney and subsequently the authors were unable to provide raw data for the analysis presented in the paper"
No further information, but we know from a previous request that the chat bot directed our mouse informant to this paper (which no longer exists).
The chat bot doesn't like the next question
So #ChatGPT confirms that a paper existed in 2018 published by #FastEddie Holmes and was retracted, yet no record exists of this paper anywhere.
Not pubmed, not google, not duckduckgo.
But a paper that did not exist prompted an investigation by @Sydney_Uni
It's clear from the title that this is a vitally important paper to the origins of the "Pandemic"...
"Spike cleavage fusion peptide motifs"
Just like the #EK1C4 paper from Zengli Shi, was this a peptide inhibitor developed in advance?
If this turns out to be true (which seems highly likely) then there are senior people at the University of Sydney who are covering up for Edward Holmes and are powerful enough to have that paper scrubbed off the internet.
What are the odds that a virus arising in at least 5 different species would all match the same sequence starting at the same point and matching a "newly discovered" human virus from 2001?
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.
It's like Georgia. Someone flood the polling station quick!
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.
The problem is that they now have 19 hours to keep the bots going.
@elonmusk please make poll voting a 2-step interaction. TY.