The tweet was posted around the same time that there was a drive to increase COVID vaccination in minority communities in the US, because many non-white communities had rejected the government propaganda.
It looks to me like #DrewComments was playing a role to increase COVID vaccination uptake in the Black community, and I wouldn't be surprised if others were recruited to the AIAN and Hispanic communities by the same people, do do the same thing in "their community"
So... the question...
Who recruited him?
Because this video doesn't sound spontaneous. It sounds like a script, with Pharma disclaimer.
"As with any vaccinations there are minor risks"
The towel is... weird.
The question then becomes.. If Drew was recruited to propagandise an experimental mRNA therapy to the Black community, from which people died...
Who is liable?
Drew?
Or the people that recruited him.
Hope you got indemnity bro.
• • •
Missing some Tweet in this thread? You can try to
force a refresh
@jsm2334 I have 3 new questions:
1⃣ why didn't you appear on the Razzaghi paper using your data?
2⃣ is your data synthetic?
3⃣ what is the binomial probability that 18/20 of a university's research team come from a group that comprises 2% of the US population, if all groups are equal?
@jsm2334 For those confused... The original thread on #OHDSI - the data curators claiming an impossible 96% efficacy rate for a type-mismatched vaccine against infection - is here.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1