Er.... @FeeRedfern @carl_jurassic why does the Epstein-linked @nyphospital turn up everywhere we look? ohdsi.org/wp-content/upl…
WHOA!
And every where we look... under every stone... we find @IQVIA_global
The "data collaborator" for every COVID study you will never see the data for.
@MartinNeil9
@IQVIA_global @MartinNeil9 BINGO. Holy crap.
This study was published in 2020 and was basically the third in the #Lancetgate series.
Completely unverifiable and no possibility of being real data.
Where did the data come from?
IQVIA. Jennifer Lane (an unknown). Oxford. OHDSI...
@nyphospital (Jeffrey Epstein)
Oxford.
Astrazeneca.
Columbia Irving.
Erasmus (Marion Koopmans)
Vanderbilt
David Geffen
Bayer
Chinese Academy (CCP)
No such thing as a "conspiracy theory" when the conspiracy is this big.
They didn't know this when they chose "88" as their theme?
Well, maybe symbolism will be their downfall.
Hades?
Give me a break.
@1979pop
And who the hell is this guy?
Absolutely nothing to see here.
I'm going to try and spell this out.
@OHDSI are a shell corporation for #BigPharma, recruiting geeks with no clinical experience to push synthetic data sets generated by @IQVIA_global to create papers that convince the world to buy their products.
That's it.
#COVIDin1tweet
@OHDSI @IQVIA_global And you know what?
If @OHDSI or @IQVIA_global don't like what I've just revealed, they can give me access to Jennifer Lane's full dataset and I will show you whether it's real.
You know why?....
@boriquagato @ndorms @jennifercelane
@OHDSI @IQVIA_global @boriquagato @ndorms @jennifercelane ...because #hydroxychloroquine is one of the safest drugs on earth and there is ZERO chance that it is associated with a 65% increased risk of cardiac mortality as claimed by @jennifercelane
This paper is literally #surgisphere 3.
You know how I know?...
@OHDSI @IQVIA_global @boriquagato @ndorms @jennifercelane Because I've been in this business longer than Jenny from the block and she had never written a first author paper of any significance before IQVIA ghost wrote this one for her.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.
It's like Georgia. Someone flood the polling station quick!
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.
The problem is that they now have 19 hours to keep the bots going.
@elonmusk please make poll voting a 2-step interaction. TY.