This is how it works.
Your hospital signs you up to an overseas EMR (health record) corporation.
They get your health data.
You get zip.
That data is used to generate artificial study data that promotes a drug, and Pharma makes $billions.
Here's an example. @addenbrookes hospital - one of the biggest hospitals in the country and a massive #BigPharma advocate...
Gives your health data to @epic.
What, you didn't know?
It's written in the T&C. Right at the bottom of a 4,400 word disclaimer.
Can't you see it?
Now comes the smart part.
Usually @NEJM or @thelancet are involved.
A noob medic comes along with a first author paper from a massive collaboration of people who don't know each other.
There are 14 data sources from different countries.
>900,000 patients.
Data amassed over 20 years up to the same year of the publication (therefore limited time for analysis).
Cleaning, matching, imputing this data would take 2 years+.
@chrismartenson
Yet we are expected to believe that an orthopaedic registrar with no prior publication record did this in a couple of months.
This is how we worked out that #surgisphere (#lancetgate) was fake.
Both @thelancet and @NEJM were involved, because they are simp journals for #BigPharma.
The study size prohibited any valid analysis in the time they proposed, it was impossible.
Which means these studies are either synthetic (created by modelling prior data sets gleaned by skimming your health data) or ghost written (written by Pharma employees with AI help).
In this case both of these things are likely to be true...
But @jennifercelane went along with it anyway. I have no idea what her contribution was but it looks like she was the "medic" front for a paper ghost written and produced by Pharma and @IQVIA_global who are the vaccine industry's data curators (or creators).
And here's the clincher.
This should have been a red flag to Jenny and @prieto_alhambra who was the supervising author.
You see, it's a simple fact that azithromycin isn't a treatment for rheumatoid arthritis. Nor a long term treatment for anything in common use.
So it's just not possible that a third of the cohort taking hydroxychloroquine were also taking azithromycin long term.
Find a rheumatologist and ask them how many patients on HCQ they also treat with azithromycin.
Long-term azithromycin use is rare - bronchiectasis and other unusual indications. If it's used long term (I've never seen someone on it) it would be low dose, not the doses suggested in this paper.
So the probability that one-third of a cohort of rheumatoid arthritis patients were also on long term azithromycin, when that is less than 1:10,000 people?
Zero.
I'm calling this paper fake until the data is available to public inspection...
"Patient level data not available".
So this paper must be assumed to be the 3rd in the #surgisphere #lancetgate scandal.
The 4th would have to be @bengoldacre's @OPENSAFELY paper in the @TheLancetRheum that is also not available to inspection.
And all these papers (including the original #surgisphere papers) appear to have been ghost written, because it's not possible for the lead authors to do what they did in the time available.
And the real people that provided the health data have no idea that their data is being used to push a false Pharma narrative that is endangering them, and making billions for the pharma companies who then pump a few quid back into the institutions.
Bargain Basement Bribery
👆👆👆this is #EMRgate.
But this 👇👇👇 is just one thread of the back-story.
Correction and apologies - @epic is not the twitter account of EPIC health care.... this was a typo.
Please feel free to remove your tag from the conversation as twitter doesn't let us edit or remove users from tweets
@chrismartenson @FeeRedfern BINGO and BOOM 💥💥💥
Here's your ghost writer.
Patrick Ryan of @OHDSI and @JanssenGlobal
The lead author should be the corresponding author.
If the corresponding author is not the lead author, it's because they don't want you asking questions of the lead author.
@jsm2334 I have 3 new questions:
1⃣ why didn't you appear on the Razzaghi paper using your data?
2⃣ is your data synthetic?
3⃣ what is the binomial probability that 18/20 of a university's research team come from a group that comprises 2% of the US population, if all groups are equal?
@jsm2334 For those confused... The original thread on #OHDSI - the data curators claiming an impossible 96% efficacy rate for a type-mismatched vaccine against infection - is here.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1