A new search of the GP prescribing database confirms a MASSIVE safety signal for fertility risk following the COVID vaccine rollout.
The one that @vikilovesfacs told you had no impact on fertility.
Well check the next tweets and then decide.
#OophGate 🧵
Here it is. The drug which skyrocketed in prescriptions after early 2021 was Estradiol.
HRT.
Why would this drug suddenly be prescribed in rapidly increasing quantities, having been at a steady level for YEARS following its fall from grace?
https://t.co/6aW8D68lKNopenprescribing.net/chemical/06040…
Of course the answer must be #ClimateChange.
One of the primary symptoms of menopause is hot flushes, and these are worse when it's warm.
So that must be it. Global warming (even though it's getting colder)
It cannot possibly be anything else that happened in early 2021.
What it definitely can't be is anything to do with the global injection of an irritant lipid nanoparticle that was known to accumulate in the ovaries, containing RNA encoding for a foreign protein.
Because if the world was injected with such an irritant or toxic product that went to the ovaries and potentially caused premature ovarian failure as a result, the regulators such as the @MHRAgovuk @TGAgovau and @US_FDA would have told us.
And they would have noticed that an early safety signal for such an event (premature ovarian failure) would have been a sudden increase in the prescribing of HRT.
Hormone replacement therapy.
Estradiol.
And the pharmacovigilance people would have halted the rollout, no?
Of course we have been here before.
In the 1970s the pharma companies thought they had "cured" the menopause by dishing out estradiol to as many women as possible.
And then the uterine cancer epidemic happened.
If this happened today, nobody would be allowed to speak out.
The point is that estradiol is not prescribed routinely.
It is not contraceptive estrogen.
The days of routinely prescribing HRT for "menopause" have gone since the Women's Health Initiative study showed a higher rate of heart disease and breast cancer. https://t.co/KiL0DBT2uPwomenshealth.gov/30-achievement…
That was 20 years ago and apart from the pharma shills like @drjengunter pushing it excessively, prescriptions for HRT - especially in the UK - are low level and very stable.
That's because the risks usually exceed the benefits over age 50.
So a TRIPLING of the prescription of HRT would be unprecedented.
And no, it's not climate change.
It can only represent one thing - that women *under 50* are suddenly being prescribed HRT in record amounts.
And this could only happen if a cohort of otherwise healthy women in their 40s (because the over 50s would be expected to enter menopause) suddenly found themselves in an early menopause.
The GPs wouldn't hesitate to prescribe HRT in that situation.
Which means....
This massive and unprecedented spike in HRT prescribing, most notable in the South East region, is due to something that happened to females aged 40-50 from March 2021 onwards that caused premature ovarian failure in unprecedented numbers.
And you can tell that the story needs to be buried because the Pharma-controlled media and their "celebrities" are pushing a new drive for hormone replacement therapy.
So that they can blame the massive rise in prescriptions on "increased awareness"
But it's another distraction and those individual women going to their GP having a sudden menopause a few years early will just be fobbed off that "it's normal".
Well, it isn't... and almost certainly the bigger issue is in the next tweet.
Which is, that if a whole cohort of 40's women are suddenly entering premature menopause...
What is happening to women under 40 who wanted to get pregnant?
And remember that @KateClancy, who pretended to be looking at this very issue, went on a rant when it was suggested two years ago that women could check their AMH levels before engaging on the COVID therapies.
The one saving grace here is that the disaster that has afflicted this newly menopausal cohort of women, if treated with any seriousness at all, could help save the fertility of those not yet affected.
By warning young women not to take these drugs without more data.
And if you are a young woman who might one day in the future want to get pregnant, speak to your doctor about an AMH test.
UPDATE: In typical fashion Viki Male posts a paper almost in unison with this thread to suggest that the AMH values are unaffected by the jabs (when tested early on without boosters).
But the paper is a sham. The data is not available to inspection and the estradiol data above… twitter.com/i/web/status/1…
@noconform101 @VikiLovesFACS Miniscule numbers
@threadreaderapp unroll
@Melchizedek1972 Lol I'm blocked and so is "it"
@ChanCha52615650 No. Nothing to do with it.
@RaginKrajun No. Nothing to do with it
@imdyingslowly No, not at all.
@Miss_Ruby11 This is nothing to do with this. The trans patients are a miniscule number in relative terms. If you don't want to read the thread, perhaps better not to comment.
@RaginKrajun I'm sorry you don't understand that HRT is not used for people trying to have children.
And your rant just gets you a block.
@JacsUniverse @VikiLovesFACS Climate change
@GooRee This isn't about pregnancy so go take your propaganda elsewhere.
I only deal in data.
@AJays_choice @VikiLovesFACS Thank Viki
@MariellaNovotny @VikiLovesFACS That's a tiny fraction
@laurelmmmmm It was a bad study?
Do you have a better one?
@SpeyGo @VikiLovesFACS This is classic pharma shillery.
If your useless vaccine worked there wouldn't be covid.
Go shill somewhere else
@laurelmmmmm Then unfortunately your statement is not helpful. It looks like it's intended to undermine the thread. I value fact based contributions, with papers or links.
Your statement is also potentially dangerous, as progestins are required for women with a uterus. Please revise.
@RYANDIDCOT @VikiLovesFACS @BBCNews Why don't you just click on the link and click it yourself?openprescribing.net
For the record these searches were archived (after the #midazolam fiasco)
@laurelmmmmm It wasn't an error. Your "advice" arrived with a statement that could put people at risk. I see you have doubled down. I'll set you free. Enjoy your gardening.
@IrateChris @RiseOfTheProles @VikiLovesFACS That's exactly what's happening.
Here, have some HRT
@IrateChris @RiseOfTheProles @VikiLovesFACS Well it should be the same as 4 years ago. But apparently not
@threedogsonekid @VikiLovesFACS I have some inside info, but the dispensing system is not as open to interrogation as the UK one
@threedogsonekid @VikiLovesFACS How convenient.... 😉
@threedogsonekid @VikiLovesFACS It wouldn't account for the massive rise, even if it were real.
There is a small and late rise in testosterone prescribing but not in 2021. And not of the order of a 200% increase.
As I said, very convenient that Davina puts this documentary out in May 2021.
@GordonDomini Pharma emboldened by the COVID con.
Everybody will be on HRT again soon.
Soma.
UPDATE: Viki Male confirms that the rise is not due to any "Davina effect" at all but due to a rapid rise in diagnoses of premature menopause, so dramatic that it spilled into hospital outpatient episodes.
Another point of note. Viki is trying to conflate all estrogen (HRT) prescriptions, the majority of which are driven by topical (vaginal) estrogen. Those are not relevant to this discussion.
The discussion here is about systemic HRT.
So when Viki says that 90% of prescriptions… https://t.co/hzuYttHiE7twitter.com/i/web/status/1…
@LastCardiology It doesn't. It shows that there is a sudden uptick in demand. And there is only one possible reason for that.
@LastCardiology Because the only women that would have driven that demand are the 40-55 age group. So something happened to that age group that hadn't happened prior to 2020.
What do you think it is?
@LastCardiology OK I think you're a troll but let's see.
Can you show me the tweet that says that this is proof of an increase in menopause in women in their 40s?
If your next tweet doesn't have the answer or a retraction I'll block you.
• • •
Missing some Tweet in this thread? You can try to
force a refresh
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.
It's like Georgia. Someone flood the polling station quick!
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.
The problem is that they now have 19 hours to keep the bots going.
@elonmusk please make poll voting a 2-step interaction. TY.