The hospital at the centre of the iatrogenic murder scandal of @evlaica's husband is @RCHTWeCare
The twitter handle is inappropriate.
If you are a nurse at #Treliske hospital who wants to get your story out anonymously, my DMs are open.
🧵
As presented, this story from @JacquiDeevoy1 represents an iatrogenic (doctor-caused) death no different from those resulting from Harold Shipman's serial murder campaign.
All Stuart needed was #3tablets antibiotics for a chest infection.
...according to his wife's testimony he was physically restrained, catheterised and forcibly injected with high dose opiates and #midazolam without consent.
This would constitute an illegal act of assault leading to an unlawful death.
Deaths arising from medical malpractice may be categorised as manslaughter in the UK.
@EVlaica's testimony is that the consultant concerned disagreed with Stuart's medical choices and as a consequence deliberately mismanaged him.
That is no longer manslaughter under UK law, sorry @RCHTWeCare, it's murder.
And unfortunately for @RCHTWeCare you are under mandatory reporting rules.
Which means that if you were aware of this act and failed to report the consultant concerned, you inherit liability.
Nobody reading the story in Jacqui's report can take away anything other than a deliberate intention to deny antibiotics at first presentation and then to administer respiratory depressants, which will kill you if you have pneumonia.
That is the #midazolam scandal that killed over 100,000 British people.
Instead of treating early for post-viral pneumonia, elderly, disabled, infirm, or - in the case of @RCHTWeCare - anybody that disagreed with the government mantra, were denied antibiotics and instead given drugs that hastened their death.
And - for those who shout "antibiotics don't treat viruses" - the following drugs do NOT treat bacterial pneumonia.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.
It's like Georgia. Someone flood the polling station quick!
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.
The problem is that they now have 19 hours to keep the bots going.
@elonmusk please make poll voting a 2-step interaction. TY.