When they said they will not stop, they didn't just mean me.
They continue to harass women and children who reject their narrative.
This account - linked to David Gorski - devoted itself to harassing a mother by posting her home on its profile.
Here's a question...
If your #bestvaccineever actually worked, why would you need to:
▶️threaten
▶️harass
▶️intimidate
▶️bully
Because it doesn't.
Most of the people you label "antivaxxers" have had plenty of vaccines.
But you got greedy. You took millions of dollars from the pharma companies and agreed to hound down anybody that disagreed with you even when people were dying because your drug trials were false.
So you decided to make bullying networks to hound people down.
You did this to
▶️doctors
▶️nurses
▶️politicians
▶️mothers
▶️fathers
▶️vaccine injury victims
Threatening everybody that disagreed with you.
And the result?
You created the biggest generation of "antivaxxers" in history.
The whole world now hates #BigPharma and the vaccine industry because of the dirty tricks you were using.
And even your own people are now deserting you.
10% of the #shotsheard group ditched you when we shone the light on them this week.
Why?
Wasn't it an honourable endeavour?...
Or was it just a money laundering scheme based on its founders getting millions of dollars from undisclosed donors (presumably Pharma corporations through BIO and other lobby groups). brokentruth.com/pharma-lobbyis…
But you failed to realise that every time you do this, the public are going to turn against you.
And every million dollar donation will mean that people will look at you and ask "why did the Public Good Project suddenly get millions of dollars 2 years before the pandemic?"
Oh, don't just take my word for it.
Here is Joe Smyser, CEO of Shots Heard, Project VCTR and the inappropriately named "Public Good Project".
In his own words.
"Antivaxxers are not nice people".
Really Joe?
Did you ever meet one?
So, here's a question for Joe Smyser.
Did you approve of or coordinate the targeted harassment (incl doxxing) of families, nurses and doctors in order to coerce the population into taking an experimental gene therapy vaccine?
Actually, don't bother. We know the answer.
Meanwhile, here are the people underpinning #shotsheard and the propaganda empire above it.
Listen to what they think of you.
Todd Wolynn - co-founder of shots heard:
"My job is to get you to be compliant... eat a healthy diet or get vaccinated"
Direct link to the video featuring Beth Hoffman (co-founder of the #shotsheard facebook group), Todd Wolynn (co-founder of shots heard) and Jaime Sidani, Beth Hoffman's co-author on multiple papers on reprogramming the population to accept vaccines. pitt.hosted.panopto.com/Panopto/Pages/…
Oops and just one thing...
Todd forgot to mention that he received over $200,000 in fees from 4 of our favourite Pharma companies.
Can't imagine why.
#ShotsGate
@BrokenTruthTV
Many of these accounts don't link to the big #shotsheard style accounts directly but through intermediaries, and as this account is likely to disappear here is the link claimed in the first tweet.
Only 1 follower. Sock account.
• • •
Missing some Tweet in this thread? You can try to
force a refresh
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.
It's like Georgia. Someone flood the polling station quick!
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.
The problem is that they now have 19 hours to keep the bots going.
@elonmusk please make poll voting a 2-step interaction. TY.