It has been a hard road fighting against corrupt entities that I never knew existed to such an extent in the halls of power. And against the relentless propaganda that has seemingly usurped most if not all of academia and medicine.
This account came about because I knew that we had been lied to in February 2020 about the origin of COVID and with the help of others we were able to prove it.
Since that time there has been a pyre of lies that we have had to unpick, whilst showing ourselves to be the ones that endeavoured to uphold the values of real science that required the pursuit of truth over politics and corruption.
The time is right to retire now because two things have happened.
The first is that the public is now becoming aware not only of what is true, but how to discern what is truth against that which is untrue. I believe that was my task and much of that work has been done.
The second is that the threats against me from groups with proven ties to pharma lobby groups have intensified. The people involved know who they are and they attempt to justify their activity by creating a bogeyman story directed at us. But that's all it is. When the dust settles and the horrendous death tally is finally counted, the people that will be most responsible are those that used their unlimited resources (supported by pharma corporations and corrupted government departments with unlimited funds and power) to silence those of us whose only crime was to highlight scientifically evidenced dangers to the public about interventions that could - and did - cause death and disability.
Those groups - mainly #shotsheard in the US and #muttoncrew in the UK with their groupies on social media, all coordinated through a central point - are merely an extension of the same groups that did exactly the same things 20 years ago in relation to Vioxx (where 30,000 people died because doctors and scientists were threatened into silence) and before that thalidomide (where 20,000 children were born without limbs because doctors and scientists were threatened into silence).
We care about this but the majority of the public and the government appear not to. There are no resources available to us and the government - who many of you trusted - have never offered any resources or protection to accounts such as ours or the people behind them. On the contrary they have shown - in the US, UK, Europe, Canada and Australia - that they will be the ones to silence us. In some cases they have threatened to imprison us.
The public remain quiet. Anger is brewing but the government and media will ensure that that anger is directed at us - the very people who showed you where corruption and malfeasance exist in establishments that should be above reproach. I predict that there will be no public protests to "protect medical whistleblowers" or "bring back Jikkyleaks". There will for instance be no public protest at the supreme court in Victoria where @realMarkHobart will be fighting for the right of a doctor to protect the fundamental and global right to bodily autonomy of patients. There will be no clamour for the pharma-affiliated bully organisations to be prosecuted for what they have done for the last 20 years. Nobody was jailed for Vioxx - or thalidomide - because the public did not demand that they were.
The media played the biggest part. They universally disparaged people as "antivaxxers" who merely wanted to retain their human rights as declared in the UN declaration on human rights. Instead they protected the very people who created this pandemic (and by extension previous pandemics). And more importantly they failed to give any voice to those of us with scientific and medical expertise who tried to raise concerns and advocate merely for the retention of the human right to bodily autonomy.
Instead, the media gave a platform to the likes of David Gorski, Tony Fauci, Albert Bourla and Peter Daszak as if they were saints instead of the face of a global biomedical mafia. Their support group of minions who threaten scientists and non-scientists, scouring their personal files and tracking their homes, children and employers know who they are. So do I. Everything is archived.
The result of this collusion between pharma, government and media (with minions acting on their behalf for a pittance in reward) was millions of deaths with not a sniff of culpability. This is not their first rodeo, but this time instead of 30,000 deaths it was 6 million and counting. And the general public never raised an eyebrow in criticism of the biomedical corporations and governmental and military entities responsible and acting in lockstep.
So the result will remain. 6 million deaths and counting this time. The next time will likely be more. And if the public again rely on the media without question to guide them through it will never stop. There is too much money to be made and power to be gained. Why would those involved stop when there was not a single protest at any regulator or any government or academic institution despite the fact that deaths were known to have occurred and been covered up with no transparency from government agencies - who should have been desperate to release every document they possess to prove to the people that they were above reproach.
The silencing of this account is just a symptom of a disease so insidious that cannot remain untreated. One person - or mouse - cannot treat this disease. I have served my time here as far as I possibly can and must now devote time to other avenues, for what they are worth.
But without the help of the public we cannot do any more. Apathy feeds corruption and only the public en masse can stop feeding it.
To those that have supported this account please now that I appreciate everything that you have done and many thousands, if not millions, either do already or will do so in time.
For now I will bow out. I will continue for the time being to interact with other accounts posts, replies and existing DMs. But there will be no more new posts, exposures or #Gates on this platform until real protections are put in place for whistleblowers.
Just one caveat.. if the threats directed at me or those around me persist or resurface, I will have no choice but to return.
Good night. God speed.
And may the #mousearmy continue its fight for truth and against corruption in science.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.
It's like Georgia. Someone flood the polling station quick!
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.
The problem is that they now have 19 hours to keep the bots going.
@elonmusk please make poll voting a 2-step interaction. TY.