Thread by @Kevin_McKernan

Dan doesn't think the SV40 virus has an origin of replication.

Let's examine why Dan is making such a public mistake.

https://twitter.com/Debunk_the_Funk/status/1723728726075031758

First lets hear from Dan's Personal Hero
Vincent Racaniello

About how this sequence Dan claims doesn't exist, actually works.

So why can't @Debunk_the_Funk find the Origin?

Dan is unaware that nomencalture in plasmid start with the Origin as base 1.
This means the sequence he is searching for is split across the beginning of the vector and the end of the vector. Base 1 and Base 5243.
See Red Ends.

When you are newb at DNA alignment and don't understand plasmid nomenclature you come to conclusions like the 'SV40 Origin of replication doesn't exist', because today is Dans first attempt at using a DNA aligner.

Here is the SV40 genome SnapGene file
mega.nz/file/hARV2DAA#…

Not the Parsons SV40 Ori Dan claims doesnt exist, is easily found if you know that it bridges the base 0 and base 5243

But Dan was so sure of himself that he had to insinuate that the Direct of the Brown Cancer Center @weldeiry and @P_J_Buckhaults were Anti-vaxxer adjacents

This would be a good time for Dan to put the ClustalW web tools down and learn to use professional tools for managing vector sequences. These gaffs are easily avoided by checking your work with 2 tools. Measure twice, attack once..

Its also worth noting that I frequently post substacks and tutorials on how my followers can replicate this work.
Even people untrained in Molecular Biology can find the SV40 Origin that Dan is incapable of locating.

https://x.com/NieceOfFester/status/1723743162374459706?s=20

So close to an admission of error..
But has to blame it on Buckhaults.

There this nothing wrong with Phils sequence.
Try it for yourself

ATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCC