Kevin McKernan Profile picture
Jan 6, 2025 20 tweets 6 min read Read on X
This is a violation of COPE guidelines regarding academic publishing ethics and has been reported to his university.

The retraction process isn't something you weaponize as a revenge motive.

You much have a specific concern over a specific paper.

To publish a vendetta motive is clear violation of the system.
@RobertKennedyJr @DrJBhattacharya @MartyMakary @MartinKulldorffImage
@liu_universitet Is this in line with your code of conduct?
Looks like one university already ditched him. Image
The University has responded quickly.

I wonder if they are aware of Lonnis role in harassing the most cited microbiologist in the world (Didier) and Lonnis impact on the death of patients who lost access to HCQ based on his ideological inquisition? Image
Note PubPeer making ad hominem and associative fallacies regarding what groups I’ve interacted with in the past.

And they cite a factchecker with conflicted funding as a source.
So scientific. Image
The Health Feedback factcheck is authored by this shill.
@BrokenTruthTV
brokentruth.com/flora-teoh-sho…
You would think after all the papers that have replicated the dsDNA contamination in the vaccines, that the trolls at PubPeer could pick up a pipette.
Instead, they use ad homs, factchecks, and associative fallacies.
Can Lonni actually point out a flaw or must he outsource this to factcheckers?Image
Lonni spends alot of time concerned about peer review.
Notice this papers of his was submitted, peer reviewed and published in 1 day. Image
This is highly unusual for that Journal Image
Here he mocks papers that are reviewed in 24 hours. Do as I say, not as I do. Image
AI platforms are not impressed with his soft social science. Does PubPeer have any complaints about less than 1 day peer review? Image
He mocked people who pointed out the Surgisphere fraud. Image
H/T @Arta_PlasmidDNA
This 1 day review paper argued for your reduced mobility during the pandemic.
Does his PubPeer cult have anything to say about this? Image
If you need more toilet paper... this soft science paper is a good source. Its so soft its 5 ply.

academic.oup.com/jtm/article/29…
Here Lonni argues for shutting down your schools.
Lots of publication bloat with editorials.
He can safely fire shots at real research while he bloats his embarrassing citation rate with fluff editorials that usually safe from retraction because they are just woke opinions. Image
As Lonni cries some more about it only being an Editorial. Image
He commonly publishes with Health Nerd.
Also known as BeijingGideon.
And his sacred PubPeer and Retraction watch are conflicted Pharma trolls.

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Kevin McKernan

Kevin McKernan Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @Kevin_McKernan

May 19
This never happens..
Except when it does.
First time- Really?
nejm.org/doi/full/10.10…
10% get cancer..
Thats must be what they meant by "rare" Image
Read 6 tweets
Feb 7
The latest BS on @biorxivpreprint Image
This paper tries to makes claims of RT-qPCR sensitivity with a LLOQ of 372,800 molecules/ml as their lowest limit of Quantiation.

As a comparison, most clinical HIV RT-qPCR tests pick up 50 molecules/ml.
Hence they have very optimistic clearance rates.
biorxiv.org/content/10.648…
0.00085ng/ml is 372,800 copies. Image
Read 7 tweets
Jan 31
It is well known from BioNtech (Lenk et al) and Sutton et al (1997) that RNA:DNA hybrids inhibit DNaseI.

What is less known is that Quadruplex Gs also inhibit DNaseI. Some exist in SV40 and we get the most signal from this qPCR amplicon.

2 Different mechanisms of DNaseI inhibition = plasmid fragmentation cannot be assumed to be uniform in the mRNA vaccines. Hence 100 fold more spike than parts of the vector.

Below is a map of the codon optimized spike where Quadruplex Gs are overlaid with GAA repeats. GAA's are stickier RNA:DNA hybrids.

Our qPCR primers are overlayed as well.
@RetsefL @KUPERWASSERLAB @weldeiry @JesslovesMJK @DJSpeicher @TracyBethHoeg @DrJBhattacharyaImage
Evans et al demonstrate DNaseI is resistant to quadruplex Gs. They also move to alternative enzymes.
nature.com/articles/s4152…
This is from Lenk et al (BioNtech).
Note the concern over GAA sequences and RNA:DNA hybrids.
Our spike qPCR primers happen to land on GAA rich and quadruplex G rich regions of Spike.
frontiersin.org/journals/molec…Image
Read 4 tweets
Jan 30
@LocasaleLab I find the RNAi worship incongruent will how that entire field was ignored when injecting billions of people with mRNAs.
There are multiple 21bp homologies to human that emerged from the haphazard codon optimizations in the modRNA vaccine and no one cared?
@LocasaleLab Receipts.
Take Pfizers vax Sequence and run it through BLAT.
Hello... anyone from the RNAi space want to speak up about this? Image
ATGTTCGTGTTCCTGGTGCTGCTGCCTCTGGTGTCCAGCCAGTGTGTGAACCTGATCACCAGAACACAGTCATACACCAACAGCTTTACCAGAGGCGTGTACTACCCCGACAAGGTGTTCAGATCCAGCGTGCTGCACTCTACCCAGGACCTGTTCCTGCCTTTCTTCAGCAACGTGACCTGGTTCCACGCCATCTCCGGCACCAATGGCACCAAGAGATTCGACAACCCCGTGCTGCCCTTCAACGACGGGGTGTACTTTGCCAGCACCGAGAAGTCCAACATCATCAGAGGCTGGATCTTCGGCACCACACTGGACAGCAAGACCCAGAGCCTGCTGATCGTGAACAACGCCACCAACGTGGTCATCAAAGTGTGCGAGTTCCAGTTCTGCAACGACCCCTTCCTGGACGTCTACTACCACAAGAACAACAAGAGCTGGATGGAAAGCGAGTTCCGGGTGTACAGCAGCGCCAACAACTGCACCTTCGAGTACGTGTCCCAGCCTTTCCTGATGGACCTGGAAGGCAAGCAGGGCAACTTCAAGAACCTGCGCGAGTTCGTGTTTAAGAACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCTATCAACCTCGGCCGGGATCTGCCTCAGGGCTTCTCTGCTCTGGAACCCCTGGTGGATCTGCCCATCGGCATCAACATCACCCGGTTTCAGACACTGCTGGCCCTGCACAGAAGCTACCTGACACCTGGCGATAGCAGCAGCGGATGGACAGCTGGTGCCGCCGCTTACTATGTGGGCTACCTGCAGCCTAGAACCTTCCTGCTGAAGTACAACGAGAACGGCACCATCACCGACGCCGTGGATTGTGCTCTGGATCCTCTGAGCGAGACAAAGTGCACCCTGAAGTCCTTCACCGTGGAAAAGGGCATCTACCAGACCAGCAACTTCCGGGTGCAGCCCACCGAATCCATCGTGCGGTTCCCCAATATCACCAATCTGTGCCCCTTCGACGAGGTGTTCAATGCCACCAGATTCGCCTCTGTGTACGCCTGGAACCGGAAGCGGATCAGCAATTGCGTGGCCGACTACTCCGTGCTGTACAACTTCGCCCCCTTCTTCGCATTCAAGTGCTACGGCGTGTCCCCTACCAAGCTGAACGACCTGTGCTTCACAAACGTGTACGCCGACAGCTTCGTGATCCGGGGAAACGAAGTGCGGCAGATTGCCCCTGGACAGACAGGCAACATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGTGTGATTGCCTGGAACAGCAACAAGCTGGACTCCAAAGTCGGCGGCAACTACAATTACAGGTACCGGCTGTTCCGGAAGTCCAATCTGAAGCCCTTCGAGCGGGACATCTCCACCGAGATCTATCAGGCCGGCAACAAGCCTTGTAACGGCGTGGCAGGCGTGAACTGCTACTTCCCACTGCAGTCCTACGGCTTTAGGCCCACATACGGCGTGGGCCACCAGCCCTACAGAGTGGTGGTGCTGAGCTTCGAACTGCTGCATGCCCCTGCCACAGTGTGCGGCCCTAAGAAAAGCACCAATCTCGTGAAGAACAAATGCGTGAACTTCAACTTCAACGGCCTGACCGGCACCGGCGTGCTGACAGAGAGCAACAAGAAGTTCCTGCCATTCCAGCAGTTTGGCCGGGATATCGCCGATACCACAGACGCCGTTAGAGATCCCCAGACACTGGAAATCCTGGACATCACCCCTTGCAGCTTCGGCGGAGTGTCTGTGATCACCCCTGGCACCAACACCAGCAATCAGGTGGCAGTGCTGTACCAGGGCGTGAACTGTACCGAAGTGCCCGTGGCCATTCACGCCGATCAGCTGACACCTACATGGCGGGTGTACTCCACCGGCAGCAATGTGTTTCAGACCAGAGCCGGCTGTCTGATCGGAGCCGAGTACGTGAACAATAGCTACGAGTGCGACATCCCCATCGGCGCTGGAATCTGCGCCAGCTACCAGACACAGACAAAGAGCCACCGGAGAGCCAGAAGCGTGGCCAGCCAGAGCATCATTGCCTACACAATGTCTCTGGGCGCCGAGAACAGCGTGGCCTACTCCAACAACTCTATCGCTATCCCCACCAACTTCACCATCAGCGTGACCACAGAGATCCTGCCTGTGTCCATGACCAAGACCAGCGTGGACTGCACCATGTACATCTGCGGCGATTCCACCGAGTGCTCCAACCTGCTGCTGCAGTACGGCAGCTTCTGCACCCAGCTGAAAAGAGCCCTGACAGGGATCGCCGTGGAACAGGACAAGAACACCCAAGAGGTGTTCGCCCAAGTGAAGCAGATCTACAAGACCCCTCCTATCAAGTACTTCGGCGGCTTCAATTTCAGCCAGATTCTGCCCGATCCTAGCAAGCCCAGCAAGCGGAGCTTCATCGAGGACCTGCTGTTCAACAAAGTGACACTGGCCGACGCCGGCTTCATCAAGCAGTATGGCGATTGTCTGGGCGACATTGCCGCCAGGGATCTGATTTGCGCCCAGAAGTTTAACGGACTGACAGTGCTGCCTCCTCTGCTGACCGATGAGATGATCGCCCAGTACACATCTGCCCTGCTGGCCGGCACAATCACAAGCGGCTGGACATTTGGAGCAGGCGCCGCTCTGCAGATCCCCTTTGCTATGCAGATGGCCTACCGGTTCAACGGCATCGGAGTGACCCAGAATGTGCTGTACGAGAACCAGAAGCTGATCGCCAACCAGTTCAACAGCGCCATCGGCAAGATCCAGGACAGCCTGAGCAGCACAGCAAGCGCCCTGGGAAAGCTGCAGGACGTGGTCAACCACAATGCCCAGGCACTGAACACCCTGGTCAAGCAGCTGTCCTCCAAGTTCGGCGCCATCAGCTCTGTGCTGAACGATATCCTGAGCAGACTGGACCCTCCTGAGGCCGAGGTGCAGATCGACAGACTGATCACAGGCAGACTGCAGAGCCTCCAGACATACGTGACCCAGCAGCTGATCAGAGCCGCCGAGATTAGAGCCTCTGCCAATCTGGCCGCCACCAAGATGTCTGAGTGTGTGCTGGGCCAGAGCAAGAGAGTGGACTTTTGCGGCAAGGGCTACCACCTGATGAGCTTCCCTCAGTCTGCCCCTCACGGCGTGGTGTTTCTGCACGTGACATATGTGCCCGCTCAAGAGAAGAATTTCACCACCGCTCCAGCCATCTGCCACGACGGCAAAGCCCACTTTCCTAGAGAAGGCGTGTTCGTGTCCAACGGCACCCATTGGTTCGTGACACAGCGGAACTTCTACGAGCCCCAGATCATCACCACCGACAACACCTTCGTGTCTGGCAACTGCGACGTCGTGATCGGCATTGTGAACAATACCGTGTACGACCCTCTGCAGCCCGAGCTGGACAGCTTCAAAGAGGAACTGGACAAGTACTTTAAGAACCACACAAGCCCCGACGTGGACCTGGGCGATATCAGCGGAATCAATGCCAGCGTCGTGAACATCCAGAAAGAGATCGACCGGCTGAACGAGGTGGCCAAGAATCTGAACGAGAGCCTGATCGACCTGCAAGAACTGGGGAAGTACGAGCAGTACATCAAGTGGCCCTGGTACATCTGGCTGGGCTTTATCGCCGGACTGATTGCCATCGTGATGGTCACAATCATGCTGTGTTGCATGACCAGCTGCTGTAGCTGCCTGAAGGGCTGTTGTAGCTGTGGCAGCTGCTGCAAGTTCGACGAGGACGATTCTGAGCCCGTGCTGAAGGGCGTGAAACTGCACTACACATGATGA
Read 8 tweets
Jan 19
On Veterans Day @CharlesRixey @JesslovesMJK
Stopped by MGC.

2 long days later we had all of his data.

It’s now published in The Journal of Independent Medicine.

It describes the mechanism of failure for the DNA contamination in the mRNA shots and why the regulators are missing it.
@JesslovesMJK @CharlesRixey @weldeiry @KUPERWASSERLAB @RetsefL @DrJBhattacharya @RWMaloneMD @RobertKennedyJr @TracyBethHoegImage
Image
Image
Image
Image
Read 5 tweets
Dec 19, 2025
Another Achs et al Fumble uncovered.
These folks don't even understand Capillary Electrophoresis.

Its becoming increasingly clear these are not honest mistakes but designed to deceive by people who are employed at a Vaccine Research Institute.
Science for Sale.

@JesslovesMJK @DJSpeicherImage
Here is the Rub.
They used a CE instrument that has a lower limit of sensitivity above the 10ng limit.
You need to be able to pick up 10X below the 10ng limit. Or 33pg/ul (300ul dose @ 10ng = 33pg/ul) Image
This is embarrassingly rigged or they are incompetent.
They ignored our comments on the preprint server and raced their paper into @Nature.

@JesslovesMJK and @DJSpeicher have their own substacks picking up other errors in this paper I'll post sortly. Image
Read 5 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Don't want to be a Premium member but still want to support us?

Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal

Or Donate anonymously using crypto!

Ethereum

0xfe58350B80634f60Fa6Dc149a72b4DFbc17D341E copy

Bitcoin

3ATGMxNzCUFzxpMCHL5sWSt4DVtS8UqXpi copy

Thank you for your support!

Follow Us!

:(