Kevin McKernan Profile picture
Dec 5, 2025 26 tweets 9 min read Read on X
The Dead Man switch has been lifted. Im not dead but the paper has been accepted.
More edits may appear as the Journal typesets this but this stack has the most current versions, Nostr links, Bitcoin links and Zenodo links. Image
Why this matters-
This paper demonstrates why the regulators cant find the DNA. The nucleases being used to remove the DNA, fail to digest the RNA:DNA hybrids. So they remove the KAN gene, fail to remove the Spike gene and only go looking for the KAN gene. This is why fluorometry sees ~100X more than qPCR.
And once again, you dont have to believe us. @CanningPharm showed you a paper from BioNtech that spells this out.
They knew this but pointed the regulators to an assay that wouldnt find it.
From the BioNtech paper (Lenk et al). Image
Irony would have it that @BioRXIV censored this.
We had received notice of its acceptance in a Journal the same day.
@DrJBhattacharya @TracyBethHoeg @RWMaloneMD @SenRonJohnson @P_McCulloughMD @RetsefL @weldeiry @KUPERWASSERLAB @JesslovesMJK @CharlesRixey @DJSpeicher Image
We actually observed this 1st in @DJSpeicher paper. We dug into it more as we could not understand why the regulators would resort to a KAN gene qPCR. Process 1 DOES NOT AMPLIFY that region of the plasmid. So they are quantitating the pre-Amplfied template plasmid. Not the actual Spike region that is amplified. This is absolute clownery.
@DJSpeicher Buckhaults lab also saw this. LOG scale different results with qPCR of KAN vs Spike. Image
@DJSpeicher Sonia Pekova also saw this.

Log scale different results from vector vs Spike (more spike).

And all of the persistence data is looking at Spike.

You do not want the transcriptionally active ORF DNA floating around a 100X over the limit. Image
@DJSpeicher For those accusing me of being performative with a Dead man switch.
Publish data on how $100B product contaminated the population with potentially oncogenic sequences and you will earn some haters.

@DJSpeicher The 5 lots in this study are fairly new. A few with expiration in 2026 so the problem has NOT been fixed.
@DJSpeicher Meant to also tag @KMilhoanMDPhD for this thread
@DJSpeicher @KMilhoanMDPhD This is the crux of the problem.
The spike region can’t be destroyed by DNaseI.

The KAN region can be destroy.
Pharma only measures KAN.

Another game of Hide The Ball. Image
@DJSpeicher @KMilhoanMDPhD Fluorometry using 1000x excess of RNaseA. Image
@DJSpeicher @KMilhoanMDPhD DNaseI-XT cleans it all up. Image
@DJSpeicher @KMilhoanMDPhD We ran 27 qPCRs for each vial
3 different targets (spike,SV40, Ori)
3 different dilutions (1X, 1:10x, 1:100x) to rule out PCR inhibition.

All performed in triplicate Image
@DJSpeicher @KMilhoanMDPhD Qubit vs qPCR
Concordance falls apart with non-spike regions. Image
@DJSpeicher @KMilhoanMDPhD ~5.3Kb fragments found in the vials.
That highlighted Blue section is one Nanopore read. Image
@DJSpeicher @KMilhoanMDPhD If you run their plasmid sequence through a cryptic promoter prediction tool, you’ll find a mammalian promoter downstream of the T7 promoter.
Someone needs to RNaseA treat the vaccine, repackage it in Lipofectamine, transfect mammalian cells and look for spike RNA.
@DJSpeicher @KMilhoanMDPhD The above experiment will tell us if the DNA is transcriptionally active.
Recall, it has an NTS so it doesn’t need to integrate to make RNA.
@DJSpeicher @KMilhoanMDPhD anandamide.substack.com/p/cryptic-prom…
@DJSpeicher @KMilhoanMDPhD The Zenodo link is burried deep in the Substack…
I’ll make a link at the top of it so it’s easier to find.

zenodo.org/records/178321…
@DJSpeicher @KMilhoanMDPhD Some people prefer the video of the experiment.
@DJSpeicher @KMilhoanMDPhD Never forget the EMA called them out on the DNaseI problem.
But they warp sped right past that concern.

The Cryptic Promoter isnt so cryptic.

Its well documented in the literature.

I'll search for information about cryptic mammalian promoters in the bacterial ColE1 origin of replication.Excellent question! Yes, the ColE1 origin (and its related pMB1/pUC variants) does contain a cryptic mammalian promoter.

Key Finding:

A 2012 study published in Nucleic Acids Research discovered that plasmids with pMB1/pUC origins (which are ColE1 derivatives) constitutively produce substantial amounts of RNA from a TATA-containing cryptic promoter within the origin of replication that functions in mammalian cells.

Important Details:

The cryptic promoter:
Contains a TATA box within the bacterial origin of replication
Is constitutively active in mammalian cells
Produces readthrough transcripts that can extend into adjacent sequences
Is highly conserved across ColE1 family members (ColE1, pMB1, pUC, and p15A)

The study found:
95% of GenBank plasmid entries use pMB1 or pUC origins (ColE1 derivatives)
The ColE1 and p15a origins are "highly homologous to the pMB1/pUC origin, particularly in the region surrounding and upstream of the transcription start site, and thus may also exhibit promoter function in eukaryotic cells"
This cryptic promoter has confounded countless reporter gene assays
The readthrough transcripts can cause false-positive results when sequences containing splice sites are inserted downstream

Implications for mRNA Vaccine Plasmids:

This is highly relevant to your DNA contamination research because:

The plasmids used for Pfizer and Moderna vaccines likely contain ColE1-type origins
If plasmid DNA contaminates the final vaccine product and enters human cells, the cryptic promoter in the ori could be transcriptionally active
This could lead to expression of adjacent sequences (like kanamycin resistance genes, portions of the SV40 sequences, or other plasmid backbone elements)
The ori region itself becomes a potential source of unintended gene expression, not just the intended mRNA coding sequences

This adds another layer of concern beyond just the presence of residual DNA - the DNA itself may contain elements that are transcriptionally active in mammalian cells.

Would you like me to search for more specific information about which origin of replication is used in the Pfizer/Moderna plasmids?
Here is the full reference for the 2012 paper:

Lemp NA, Hiraoka K, Kasahara N, Logg CR. Cryptic transcripts from a ubiquitous plasmid origin of replication confound tests for cis-regulatory function. Nucleic Acids Res. 2012 Aug;40(15):7280-90. doi: 10.1093/nar/gks451. Epub 2012 May 22. PMID: 22618870; PMCID: PMC3424574.

Additional Access Information:

Journal: Nucleic Acids Research
Volume: 40, Issue 15
Pages: 7280-7290
Published: August 1, 2012 (Epub: May 22, 2012)
DOI: doi.org/10.1093/nar/gk…
PubMed ID: 22618870
PMC ID: PMC3424574 (Free full text available)

Authors:
Nathan A. Lemp (Department of Molecular and Medical Pharmacology, UCLA)
Kei Hiraoka (Department of Medicine, UCLA)
Noriyuki Kasahara (Department of Molecular and Medical Pharmacology, UCLA)
Christopher R. Logg (Department of Medicine, UCLA)

This is an open access article, so you can freely access the full text through:
PubMed Central: ncbi.nlm.nih.gov/pmc/articles/P…
Oxford Academic: academic.oup.com/nar/article/40…

This is a highly important reference for your work on plasmid DNA contamination in mRNA vaccines, as it definitively demonstrates that the bacterial origin of replication sequences commonly used in vaccine production plasmids contain cryptic mammalian promoter activity.

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Kevin McKernan

Kevin McKernan Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @Kevin_McKernan

Feb 7
The latest BS on @biorxivpreprint Image
This paper tries to makes claims of RT-qPCR sensitivity with a LLOQ of 372,800 molecules/ml as their lowest limit of Quantiation.

As a comparison, most clinical HIV RT-qPCR tests pick up 50 molecules/ml.
Hence they have very optimistic clearance rates.
biorxiv.org/content/10.648…
0.00085ng/ml is 372,800 copies. Image
Read 7 tweets
Jan 31
It is well known from BioNtech (Lenk et al) and Sutton et al (1997) that RNA:DNA hybrids inhibit DNaseI.

What is less known is that Quadruplex Gs also inhibit DNaseI. Some exist in SV40 and we get the most signal from this qPCR amplicon.

2 Different mechanisms of DNaseI inhibition = plasmid fragmentation cannot be assumed to be uniform in the mRNA vaccines. Hence 100 fold more spike than parts of the vector.

Below is a map of the codon optimized spike where Quadruplex Gs are overlaid with GAA repeats. GAA's are stickier RNA:DNA hybrids.

Our qPCR primers are overlayed as well.
@RetsefL @KUPERWASSERLAB @weldeiry @JesslovesMJK @DJSpeicher @TracyBethHoeg @DrJBhattacharyaImage
Evans et al demonstrate DNaseI is resistant to quadruplex Gs. They also move to alternative enzymes.
nature.com/articles/s4152…
This is from Lenk et al (BioNtech).
Note the concern over GAA sequences and RNA:DNA hybrids.
Our spike qPCR primers happen to land on GAA rich and quadruplex G rich regions of Spike.
frontiersin.org/journals/molec…Image
Read 4 tweets
Jan 30
@LocasaleLab I find the RNAi worship incongruent will how that entire field was ignored when injecting billions of people with mRNAs.
There are multiple 21bp homologies to human that emerged from the haphazard codon optimizations in the modRNA vaccine and no one cared?
@LocasaleLab Receipts.
Take Pfizers vax Sequence and run it through BLAT.
Hello... anyone from the RNAi space want to speak up about this? Image
ATGTTCGTGTTCCTGGTGCTGCTGCCTCTGGTGTCCAGCCAGTGTGTGAACCTGATCACCAGAACACAGTCATACACCAACAGCTTTACCAGAGGCGTGTACTACCCCGACAAGGTGTTCAGATCCAGCGTGCTGCACTCTACCCAGGACCTGTTCCTGCCTTTCTTCAGCAACGTGACCTGGTTCCACGCCATCTCCGGCACCAATGGCACCAAGAGATTCGACAACCCCGTGCTGCCCTTCAACGACGGGGTGTACTTTGCCAGCACCGAGAAGTCCAACATCATCAGAGGCTGGATCTTCGGCACCACACTGGACAGCAAGACCCAGAGCCTGCTGATCGTGAACAACGCCACCAACGTGGTCATCAAAGTGTGCGAGTTCCAGTTCTGCAACGACCCCTTCCTGGACGTCTACTACCACAAGAACAACAAGAGCTGGATGGAAAGCGAGTTCCGGGTGTACAGCAGCGCCAACAACTGCACCTTCGAGTACGTGTCCCAGCCTTTCCTGATGGACCTGGAAGGCAAGCAGGGCAACTTCAAGAACCTGCGCGAGTTCGTGTTTAAGAACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCTATCAACCTCGGCCGGGATCTGCCTCAGGGCTTCTCTGCTCTGGAACCCCTGGTGGATCTGCCCATCGGCATCAACATCACCCGGTTTCAGACACTGCTGGCCCTGCACAGAAGCTACCTGACACCTGGCGATAGCAGCAGCGGATGGACAGCTGGTGCCGCCGCTTACTATGTGGGCTACCTGCAGCCTAGAACCTTCCTGCTGAAGTACAACGAGAACGGCACCATCACCGACGCCGTGGATTGTGCTCTGGATCCTCTGAGCGAGACAAAGTGCACCCTGAAGTCCTTCACCGTGGAAAAGGGCATCTACCAGACCAGCAACTTCCGGGTGCAGCCCACCGAATCCATCGTGCGGTTCCCCAATATCACCAATCTGTGCCCCTTCGACGAGGTGTTCAATGCCACCAGATTCGCCTCTGTGTACGCCTGGAACCGGAAGCGGATCAGCAATTGCGTGGCCGACTACTCCGTGCTGTACAACTTCGCCCCCTTCTTCGCATTCAAGTGCTACGGCGTGTCCCCTACCAAGCTGAACGACCTGTGCTTCACAAACGTGTACGCCGACAGCTTCGTGATCCGGGGAAACGAAGTGCGGCAGATTGCCCCTGGACAGACAGGCAACATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGTGTGATTGCCTGGAACAGCAACAAGCTGGACTCCAAAGTCGGCGGCAACTACAATTACAGGTACCGGCTGTTCCGGAAGTCCAATCTGAAGCCCTTCGAGCGGGACATCTCCACCGAGATCTATCAGGCCGGCAACAAGCCTTGTAACGGCGTGGCAGGCGTGAACTGCTACTTCCCACTGCAGTCCTACGGCTTTAGGCCCACATACGGCGTGGGCCACCAGCCCTACAGAGTGGTGGTGCTGAGCTTCGAACTGCTGCATGCCCCTGCCACAGTGTGCGGCCCTAAGAAAAGCACCAATCTCGTGAAGAACAAATGCGTGAACTTCAACTTCAACGGCCTGACCGGCACCGGCGTGCTGACAGAGAGCAACAAGAAGTTCCTGCCATTCCAGCAGTTTGGCCGGGATATCGCCGATACCACAGACGCCGTTAGAGATCCCCAGACACTGGAAATCCTGGACATCACCCCTTGCAGCTTCGGCGGAGTGTCTGTGATCACCCCTGGCACCAACACCAGCAATCAGGTGGCAGTGCTGTACCAGGGCGTGAACTGTACCGAAGTGCCCGTGGCCATTCACGCCGATCAGCTGACACCTACATGGCGGGTGTACTCCACCGGCAGCAATGTGTTTCAGACCAGAGCCGGCTGTCTGATCGGAGCCGAGTACGTGAACAATAGCTACGAGTGCGACATCCCCATCGGCGCTGGAATCTGCGCCAGCTACCAGACACAGACAAAGAGCCACCGGAGAGCCAGAAGCGTGGCCAGCCAGAGCATCATTGCCTACACAATGTCTCTGGGCGCCGAGAACAGCGTGGCCTACTCCAACAACTCTATCGCTATCCCCACCAACTTCACCATCAGCGTGACCACAGAGATCCTGCCTGTGTCCATGACCAAGACCAGCGTGGACTGCACCATGTACATCTGCGGCGATTCCACCGAGTGCTCCAACCTGCTGCTGCAGTACGGCAGCTTCTGCACCCAGCTGAAAAGAGCCCTGACAGGGATCGCCGTGGAACAGGACAAGAACACCCAAGAGGTGTTCGCCCAAGTGAAGCAGATCTACAAGACCCCTCCTATCAAGTACTTCGGCGGCTTCAATTTCAGCCAGATTCTGCCCGATCCTAGCAAGCCCAGCAAGCGGAGCTTCATCGAGGACCTGCTGTTCAACAAAGTGACACTGGCCGACGCCGGCTTCATCAAGCAGTATGGCGATTGTCTGGGCGACATTGCCGCCAGGGATCTGATTTGCGCCCAGAAGTTTAACGGACTGACAGTGCTGCCTCCTCTGCTGACCGATGAGATGATCGCCCAGTACACATCTGCCCTGCTGGCCGGCACAATCACAAGCGGCTGGACATTTGGAGCAGGCGCCGCTCTGCAGATCCCCTTTGCTATGCAGATGGCCTACCGGTTCAACGGCATCGGAGTGACCCAGAATGTGCTGTACGAGAACCAGAAGCTGATCGCCAACCAGTTCAACAGCGCCATCGGCAAGATCCAGGACAGCCTGAGCAGCACAGCAAGCGCCCTGGGAAAGCTGCAGGACGTGGTCAACCACAATGCCCAGGCACTGAACACCCTGGTCAAGCAGCTGTCCTCCAAGTTCGGCGCCATCAGCTCTGTGCTGAACGATATCCTGAGCAGACTGGACCCTCCTGAGGCCGAGGTGCAGATCGACAGACTGATCACAGGCAGACTGCAGAGCCTCCAGACATACGTGACCCAGCAGCTGATCAGAGCCGCCGAGATTAGAGCCTCTGCCAATCTGGCCGCCACCAAGATGTCTGAGTGTGTGCTGGGCCAGAGCAAGAGAGTGGACTTTTGCGGCAAGGGCTACCACCTGATGAGCTTCCCTCAGTCTGCCCCTCACGGCGTGGTGTTTCTGCACGTGACATATGTGCCCGCTCAAGAGAAGAATTTCACCACCGCTCCAGCCATCTGCCACGACGGCAAAGCCCACTTTCCTAGAGAAGGCGTGTTCGTGTCCAACGGCACCCATTGGTTCGTGACACAGCGGAACTTCTACGAGCCCCAGATCATCACCACCGACAACACCTTCGTGTCTGGCAACTGCGACGTCGTGATCGGCATTGTGAACAATACCGTGTACGACCCTCTGCAGCCCGAGCTGGACAGCTTCAAAGAGGAACTGGACAAGTACTTTAAGAACCACACAAGCCCCGACGTGGACCTGGGCGATATCAGCGGAATCAATGCCAGCGTCGTGAACATCCAGAAAGAGATCGACCGGCTGAACGAGGTGGCCAAGAATCTGAACGAGAGCCTGATCGACCTGCAAGAACTGGGGAAGTACGAGCAGTACATCAAGTGGCCCTGGTACATCTGGCTGGGCTTTATCGCCGGACTGATTGCCATCGTGATGGTCACAATCATGCTGTGTTGCATGACCAGCTGCTGTAGCTGCCTGAAGGGCTGTTGTAGCTGTGGCAGCTGCTGCAAGTTCGACGAGGACGATTCTGAGCCCGTGCTGAAGGGCGTGAAACTGCACTACACATGATGA
Read 8 tweets
Jan 19
On Veterans Day @CharlesRixey @JesslovesMJK
Stopped by MGC.

2 long days later we had all of his data.

It’s now published in The Journal of Independent Medicine.

It describes the mechanism of failure for the DNA contamination in the mRNA shots and why the regulators are missing it.
@JesslovesMJK @CharlesRixey @weldeiry @KUPERWASSERLAB @RetsefL @DrJBhattacharya @RWMaloneMD @RobertKennedyJr @TracyBethHoegImage
Image
Image
Image
Image
Read 5 tweets
Dec 19, 2025
Another Achs et al Fumble uncovered.
These folks don't even understand Capillary Electrophoresis.

Its becoming increasingly clear these are not honest mistakes but designed to deceive by people who are employed at a Vaccine Research Institute.
Science for Sale.

@JesslovesMJK @DJSpeicherImage
Here is the Rub.
They used a CE instrument that has a lower limit of sensitivity above the 10ng limit.
You need to be able to pick up 10X below the 10ng limit. Or 33pg/ul (300ul dose @ 10ng = 33pg/ul) Image
This is embarrassingly rigged or they are incompetent.
They ignored our comments on the preprint server and raced their paper into @Nature.

@JesslovesMJK and @DJSpeicher have their own substacks picking up other errors in this paper I'll post sortly. Image
Read 5 tweets
Dec 15, 2025
Image
Image
Note, its unique to that wonderful Furin Cleavage site. Image
Read 4 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Don't want to be a Premium member but still want to support us?

Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal

Or Donate anonymously using crypto!

Ethereum

0xfe58350B80634f60Fa6Dc149a72b4DFbc17D341E copy

Bitcoin

3ATGMxNzCUFzxpMCHL5sWSt4DVtS8UqXpi copy

Thank you for your support!

Follow Us!

:(