Following the science my pert arse. They knew, we all knew that lockdown was needed in September, or October, or Last week. WHAT MYSTERIOUS BLACK MAGIC DID NEW ZEALAND HAVE THAT WE DON'T?
Lockdown skeptics. What a contemptible rash of cyphers, crushingly vapid grifters with not the brains nor the insight to even vaguely process the fartknocking poison that blarts from their stupid manmouths, like a weeping sore that would heal if they would only stop tonguing it.
Arrogant shitwits, who if they only knew that they know nothing, that would be something. But they don’t. And instead, bluster their way with fingers crossed against FUCKING EVOLUTION.
I’m going to drink whisky and watch Buffy. It’s boring being right all the fucking time. It’s a curse. Thank you and GOODNIGHT.
Magnificent

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Dr Adam Rutherford

Dr Adam Rutherford Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @AdamRutherford

16 Dec
I see that there is a lot of chat about ancestry and indigeneity, two complex and profoundly misunderstood concepts. Here’s a thread 1/N - I have written about these ideas extensively, in two books; bit.ly/3r5iLDR
Ancestry rapidly becomes a matted web rather than a tree. Claims of ancestral purity are absurd. We are descended from multitudes, and don’t bear DNA from actual ancestors after very few generations. (fig. from @Graham_Coop
With both ancestry and indigeneity, the pertinent question is ‘when?’ If you claim ancestry from a certain group of people, then you are timestamping when you consider these ancestors to be important (to you). 3/N
Read 24 tweets
13 Dec
Oh heavens. Briefly, the D in PhD, DPhil, EdD (et al) stands for Doctor, this qualification is a doctorate. It comes from the Latin docere - to teach. 1/n
It predates the use of doctor by medical practitioners, but society has agreed by consensus to refer to physicians as doctor, regardless of whether they have doctorates. This is fine and invoking an etymological origin doesn’t help. Dr Jill Biden is a doctor. 2/n
Oh yes it’s hilarious to say that someone who has a PhD in history can’t deliver a baby, but only if you’re a drooling gurgleturd. I myself have delivered 3 babies and also have a PhD, not in delivering babies but in developmental genetics. 3/n
Read 9 tweets
30 Nov
The @DeepMind protein folding result is really incredible, and incredibly important. But I know it’s pretty tricky to understand, so here’s a megathread, with a bit of Biology 101, for @holland_tom @thehistoryguy
et al.

bit.ly/2JnKQoF
@DeepMind @holland_tom @thehistoryguy Here we go: Genes are long strings of molecules made up of an alphabet of four ‘letters’

e.g.

gacgaagagcccatgatcaacgac
@DeepMind @holland_tom @thehistoryguy Each triplet of letters encodes an amino acid (which we code as capital letters)

gac gaa gag ccc atg atc aac gac

translates to

D. E. E. P. M. I. N. D.
Read 16 tweets
15 Nov
I'm seeing a lot of chat about PCR and COVID, some of it quite bonkers. So here’s a PCR 101.

DNA is very small and therefore not easy to detect. PCR is a tool for multiplying specific bits of DNA from a few to billions, thus making it easy to detect. 1/n
PCR is a standard tool in molecular biology, and has been for decades. It was, by the way, invented by Kary Mullis, who claims to have come up with the idea whilst tripping balls on LSD. Mullis was a bit of a jerk btw, an AIDS and Climate Change denialist. 2/n Kary Mullis, who was a bit of a jerk
Right, so DNA is a DOUBLE helix, meaning it has two strands made up of chains of just 4 ‘letters’ that pair up in a specific way (that is, ‘complementary’): A pairs with T, C pairs with G. a bit like this.

GAACTTAATTAA
CTTGAATTAATT

3/n
Read 17 tweets
21 Oct
James Randi RIP, the Great Randi.

My quick James Randi story. I only met him once, and he told me this tale, which you could stop at almost any point and it would still be an amazing story. He said… 1/n James Randi
‘When I was on Happy Days, the Fonz and I were going to have lunch with Richie Cunningham…’

I mean, it’s a good opener.
We went to a Mexican restaurant, that was set back from the street by a long dark corridor, the only light for which came from the street door. As we were in this tunnel, suddenly, the light is blocked and we are in pitch black. 3/n
Read 5 tweets
21 Oct
I wonder where they stand on social constructionism. In fact, I demand to know this governments views on meta-ethical relativism. I DEMAND IT.
In fact, I think the Government should take a stand on all manner of academic disputes and topics. Group selection? WHO IS THE MINISTER FOR ANTS.
Abiogenesis: WILL THE RIGHT HONOURABLE MEMBER CLARIFY IF SHE SUPPORTS THE RNA WORLD HYPOTHESIS DESPITE THE FACT THAT THERMODYNAMIC EQUILIBRIUM VIA PROTON GRADIENTS IS A BETTER EXPLANATION FOR THE TRANSITION FROM GEOCHEMISTRY TO BIOCHEMISTRY IN THE HADEAN?
Read 5 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Too expensive? Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal Become our Patreon

Thank you for your support!

Follow Us on Twitter!