For a 9 sigma drop in birth rates to have happened in Jan-Mar 2022, something dramatic had to have happened to stop pregnancies occurring in March to June 2021.
I wonder what that could be?
Were couples depressed? Looking to move house? Too busy?
In general birth rates are surprisingly stable year-to-year with long term cycles. There are seasonal peaks and troughs which are pretty reliable. Every midwife knows.
But this is well outside normal.
Big red arrow time.
It definitely has nothing to do with the the fact, that, rather than staying at the site of injection as promised, their own data showed that the LNPs not only distributed to the ovaries and testes but accumulated.
I must give credit to @mkeulemans for pointing out an error in my chart.
I have had to recreate it as the first years' data incorrect.
Here is the corrected chart.
I should have spotted this because the stability of the data was too pronounced. But remember that there was a significant influx of migration to Germany in those years 2011-2015, so we need to look at the stable years 2016-2021 and compare.
Errors bars are SD (2016-21)
The average monthly birth figure
for Q1 2016 - 2021 is 61873.
The SD is 678.
The Q1 2022 the figure is 54871.
The drop is 7002.
That is 10.3 sigma.
It's worse.
So, apologies for not triple checking my data and thanks again to eagle eyed critics for the correction.
I'd like to say that it changes the rest of the thread, and that there is no problem here - but it doesn't and there is.
I was looking for this so thank you @NicolienvGelder data showing how the younger population expanded in Germany from 2011- 2015.
Hence why you can't use those years reliably in calculating SD for this purpose (unless you wanted to hide something)
@SECGov @Kevin_McKernan @SabinehazanMD Wow so this company is claiming influence with 11,000 scientists and multiple links lead back to pharma and the gene therapy corporations.
Broad institute. Who could have guessed?
#pubpeergate
@Yale could be up to their necks in the biggest HIPAA scandal since @UChicago
This is how the scam appears to have worked.
Harlan Krumholz owns a patent for managing health data through an app. "Hugo health" was the middle man providing the app to bait people claiming to be vaccine injured to join a study called LISTEN. But it was essentially being run on behalf of Pfizer/Janssen who paid him $3m in "research grants".
Thousands of injured signed up but only 241 patients were used in the "study" of which the publications were irrelevant and showed nothing other than "the vaccines saved millions of lives" bla bla. Nothing helpful for the vaccine injured at all.
But the bombshell - the data that they provided was able to be sold off to anyone they wanted to. It was in the consent form that most people didn't read. The data was held on hugo.health which has now gone. It was NOT HIPAA compliant.
How did we know that hugo.health's servers were not HIPAA compliant?
Yale told the participants in a email in July 2024 (attached).
So where did all that health data go?
Was it sold off to the highest bidder or used in a blackmail campaign against vulnerable people who were vaccine injured and couldn't work? (Like those that have targeted our accounts recently)
We don't know. But you can be damn sure that Yale knows, and took secret action to remedy the situation having already taken millions of dollars from pharma to run studies that undermined the vaccine injured.
That is why there is so much animosity suddenly being directed at the vaccine injured. They want to bury this story.
Yale could be in very big trouble.
They deserve a hashtag.
#YaleGate
@Yale @UChicago For those confused, please understand what a "limited hangout" is here. While you are rejoicing on the scraps of Daily Mail fodder, the pharma companies' new narrative is enshrined by those very articles.
@jsm2334 I have 3 new questions:
1⃣ why didn't you appear on the Razzaghi paper using your data?
2⃣ is your data synthetic?
3⃣ what is the binomial probability that 18/20 of a university's research team come from a group that comprises 2% of the US population, if all groups are equal?
@jsm2334 For those confused... The original thread on #OHDSI - the data curators claiming an impossible 96% efficacy rate for a type-mismatched vaccine against infection - is here.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄