For a 9 sigma drop in birth rates to have happened in Jan-Mar 2022, something dramatic had to have happened to stop pregnancies occurring in March to June 2021.
I wonder what that could be?
Were couples depressed? Looking to move house? Too busy?
In general birth rates are surprisingly stable year-to-year with long term cycles. There are seasonal peaks and troughs which are pretty reliable. Every midwife knows.
But this is well outside normal.
Big red arrow time.
It definitely has nothing to do with the the fact, that, rather than staying at the site of injection as promised, their own data showed that the LNPs not only distributed to the ovaries and testes but accumulated.
I must give credit to @mkeulemans for pointing out an error in my chart.
I have had to recreate it as the first years' data incorrect.
Here is the corrected chart.
I should have spotted this because the stability of the data was too pronounced. But remember that there was a significant influx of migration to Germany in those years 2011-2015, so we need to look at the stable years 2016-2021 and compare.
Errors bars are SD (2016-21)
The average monthly birth figure
for Q1 2016 - 2021 is 61873.
The SD is 678.
The Q1 2022 the figure is 54871.
The drop is 7002.
That is 10.3 sigma.
It's worse.
So, apologies for not triple checking my data and thanks again to eagle eyed critics for the correction.
I'd like to say that it changes the rest of the thread, and that there is no problem here - but it doesn't and there is.
I was looking for this so thank you @NicolienvGelder data showing how the younger population expanded in Germany from 2011- 2015.
Hence why you can't use those years reliably in calculating SD for this purpose (unless you wanted to hide something)
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.
It's like Georgia. Someone flood the polling station quick!
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.
The problem is that they now have 19 hours to keep the bots going.
@elonmusk please make poll voting a 2-step interaction. TY.