Jikkyleaks 🐭 Profile picture
Jun 26, 2022 17 tweets 9 min read Read on X
This is a massive safety signal for infertility. Germany's FIRST report of birth rates since the rollout.

Remember that the birth rate data is 9 months too late.

If the next quarter is worse, this is Children of Men scenario. Image
For the years 2011-2021 the average number of births is 63,911 for the Jan-Mar quarter, with a standard deviation of 1015

The drop to 54871 for 2022 is approx 9 SD.

9 Sigma. Unicorn events.

The money people understand this.

@chrismartenson
seekingalpha.com/instablog/5172… ImageImage
For a 9 sigma drop in birth rates to have happened in Jan-Mar 2022, something dramatic had to have happened to stop pregnancies occurring in March to June 2021.

I wonder what that could be?
Were couples depressed? Looking to move house? Too busy?

duckduckgo.com/?q=fertility+n… Image
In general birth rates are surprisingly stable year-to-year with long term cycles. There are seasonal peaks and troughs which are pretty reliable. Every midwife knows.

But this is well outside normal.
Big red arrow time.
Image
In the Children of Men, the midwives were the first to notice. The phone stopped ringing. But it only affected humans.

Nobody listened to the midwives. In today's equivalent we are not allowed to speak. Not allowed to raise concerns.
btchflcks.com/2013/04/the-pl… Image
And it's not just Germany. This is an 8% drop even before March 2022 figures are released int he @UKHSA vaccine surveillance reports.

And yeah, you can say "but it's only 2 months" - so let's see the latest data. The UKHSA has it.
assets.publishing.service.gov.uk/government/upl… Image
Not just UK, not just Germany.
North Dakota provisional data showing another drop of 11% for Feb-April.

Unprecedented for a state that has a stable birth rate with SD<5% of mean
h/t @ichudov
health.nd.gov/vital/vr-publi… ImageImage
It definitely has nothing to do with the the fact, that, rather than staying at the site of injection as promised, their own data showed that the LNPs not only distributed to the ovaries and testes but accumulated.

What could possibly go wrong?
[tga.gov.au/sites/default/…] ImageImage
I dunno. Probably just a blip. Coincidence. What do I know, I'm just a mouse.
@1979pop

dailymotion.com/video/xqrq5f
[Source for Official German data: www-genesis.destatis.de/genesis/online…]
Hold up folks!

I must give credit to @mkeulemans for pointing out an error in my chart.

I have had to recreate it as the first years' data incorrect.

Here is the corrected chart. Image
I should have spotted this because the stability of the data was too pronounced. But remember that there was a significant influx of migration to Germany in those years 2011-2015, so we need to look at the stable years 2016-2021 and compare.

Errors bars are SD (2016-21) ImageImage
The average monthly birth figure
for Q1 2016 - 2021 is 61873.
The SD is 678.

The Q1 2022 the figure is 54871.
The drop is 7002.

That is 10.3 sigma.

It's worse.
So, apologies for not triple checking my data and thanks again to eagle eyed critics for the correction.

I'd like to say that it changes the rest of the thread, and that there is no problem here - but it doesn't and there is.
I was looking for this so thank you @NicolienvGelder data showing how the younger population expanded in Germany from 2011- 2015.

Hence why you can't use those years reliably in calculating SD for this purpose (unless you wanted to hide something)

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Jikkyleaks 🐭

Jikkyleaks 🐭 Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @Jikkyleaks

Nov 10
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 No. They have not monitored them. We have an FOI on this
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 TGA FOI 5274. Refused.
(part 1 of 2).

The TGA has no idea how many miscarriages occurred after COVID vaccination because they had no interest.

Their only interest is in protecting their income stream and the Bollinger.

@SenatorRennick @DrJulieSladden @BroadbentMP Image
Image
Image
Image
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 @SenatorRennick @DrJulieSladden @BroadbentMP TGA FOI 5274. Refused.
(part 2 of 2).

No pharmacovigilance was performed.
The TGA lied.

#placentagate Image
Image
Image
Read 5 tweets
Nov 7
Are you looking for this @VaccineMole ?

Declared "BGH polyA" sequence (226bp): CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTG
CCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTAT
TCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGAT
GCGGTGGGCTCTATGG

Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC

So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...

jbc.org/article/S0021-…

I'll try and find the missing sequence
#SV40Gate #PlasmidGateImage
Image
@Kevin_McKernan @VaccineMole Add in a CMV promoter for good measure and perhaps a soupcon of cancer to boot.

THIS IS WHY YOU DO NOT PUT PLASMIDS INTO LIPID NANOPARTICLES AND TRANSFECT THEM INTO HUMANS.
pmc.ncbi.nlm.nih.gov/articles/PMC26…

x.com/Jikkyleaks/sta…
Here it is.
The Oxford plasmid.
"SpyTag" and "SnoopTag" and a CMV promoter with the moo cow equivalent of SV40 in the PolyA.

I'm sure it's just a coincidence.

#TagGate
@FeeRedfern @JesslovesMJK @double_christ
ncbi.nlm.nih.gov/nucleotide/KU3…
ncbi.nlm.nih.gov/nucleotide/KY9…
pubmed.ncbi.nlm.nih.gov/26781591/Image
Image
Read 7 tweets
Aug 10
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
@DiedSuddenly_ Addendum: Some undeclared replication of images from the Jeon paper in 2022, same journal.
Jeon (left):
Lee (right):


@JesslovesMJK @Kevin_McKernan
#NanoGate ijvtpr.com/index.php/IJVT…
mail.ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄

#NanoGate Image
Read 4 tweets
Aug 10
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag

My view reading this is:

This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.

I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.Image
Image
Image
Image
@DiedSuddenly_ A bowling alley?

I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.

This was from 2022:


I wonder if they targeted Broudy to add some credence to the LARP. ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
Read 4 tweets
Jun 16
@SenatorRennick The #3tablets protocols and #midazolam murders were the primary drivers of "COVID" death prior to the GMO rollout.

The publishers, who remain nameless, should be called to give evidence.covid19evidence.net.au
What in the holy hell?

The website which was used to propagandise the treatment of COVID during 2020-2024, and withhold effective treatments from people who then died..

Is now an air freight site.

THIS IS WHY WE ARCHIVE.

@tonynikolic10 @BroadbentMPcovid19evidence.net.auImage
https://archive.is/dEBZ1
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.

It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law
archive.is/dEBZ1
Read 4 tweets
Jan 25
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.

It's like Georgia. Someone flood the polling station quick! Image
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.

The problem is that they now have 19 hours to keep the bots going.

@elonmusk please make poll voting a 2-step interaction. TY.
Image
Image
Read 9 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Don't want to be a Premium member but still want to support us?

Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal

Or Donate anonymously using crypto!

Ethereum

0xfe58350B80634f60Fa6Dc149a72b4DFbc17D341E copy

Bitcoin

3ATGMxNzCUFzxpMCHL5sWSt4DVtS8UqXpi copy

Thank you for your support!

Follow Us!

:(