Jikkyleaks 🐭 Profile picture
Dec 29, 2022 6 tweets 3 min read Read on X
What are the odds?

Of the 382 batches of COVID vaccine on the TGA's batch log, only 10 had more than 1 death recorded in FOI 4077... [= 2.6%]

Of the 8 batches that were "shelf extended" from Feb 2022 to Nov 2022, 4 were on that list [= 50%]

[Answer in next tweet]
These are the batches that had a shelf life extension for more than NINE MONTHS.

Of the 10 batches with more than 1 death, 5 of them were in the "shelf life extended" release from the TGA (Dept of Health)
Assuming even distribution of batches (we don't have information otherwise, because that is withheld from us so....)

The probability of "4 hits in 8 trials" where the underlying probability of a "hit" is 2.6% is....

0.003% - or 3 in 100,000.
@chrismartenson
Which means that this is not a random event.

It means that the fact that those batches appear on that list is not by accident.

The TGA made a decision to extend the shelf life of those batches ignoring the red flag in the Agilent analyses....
And if there were any deaths after those shelf lives were extended...

Well, whoever wrote this document might need to get a lawyer.

#justsayin
[H/t to the #mousearmy for finding this document]
Source...

sydneynorthhealthnetwork.org.au/wp-content/upl…

Note that this document was specified for "providers of disability residential accommodation".

I hope this was just another coincidence this time...

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Jikkyleaks 🐭

Jikkyleaks 🐭 Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @Jikkyleaks

Feb 23
WHOA!!! 🧀

@Yale could be up to their necks in the biggest HIPAA scandal since @UChicago

This is how the scam appears to have worked.

Harlan Krumholz owns a patent for managing health data through an app. "Hugo health" was the middle man providing the app to bait people claiming to be vaccine injured to join a study called LISTEN. But it was essentially being run on behalf of Pfizer/Janssen who paid him $3m in "research grants".

Thousands of injured signed up but only 241 patients were used in the "study" of which the publications were irrelevant and showed nothing other than "the vaccines saved millions of lives" bla bla. Nothing helpful for the vaccine injured at all.

But the bombshell - the data that they provided was able to be sold off to anyone they wanted to. It was in the consent form that most people didn't read. The data was held on hugo.health which has now gone. It was NOT HIPAA compliant.

How did we know that hugo.health's servers were not HIPAA compliant?

Yale told the participants in a email in July 2024 (attached).

So where did all that health data go?

Was it sold off to the highest bidder or used in a blackmail campaign against vulnerable people who were vaccine injured and couldn't work? (Like those that have targeted our accounts recently)

We don't know. But you can be damn sure that Yale knows, and took secret action to remedy the situation having already taken millions of dollars from pharma to run studies that undermined the vaccine injured.

That is why there is so much animosity suddenly being directed at the vaccine injured. They want to bury this story.

Yale could be in very big trouble.
They deserve a hashtag.
#YaleGate

@RobertKennedyJr @SECGov @AGHuff @chrismartenson

Patent:
patents.justia.com/inventor/harla…
Pubmed showing over 1000 papers (not possible for a clinician researcher writing his own papers):
pubmed.ncbi.nlm.nih.gov/?term=krumholz…
LISTEN studies:
pubmed.ncbi.nlm.nih.gov/?term=krumholz…Image
Image
Image
@Yale @UChicago For those confused, please understand what a "limited hangout" is here. While you are rejoicing on the scraps of Daily Mail fodder, the pharma companies' new narrative is enshrined by those very articles.

"Injuries are very rare but it was worth it"

Getting more information about this pharma honeypot.

$2m to Iwasaki.

How much more pharmaceutical net went into this group to push boosters?

Image
Read 5 tweets
Dec 12, 2024
@jsm2334 I have 3 new questions:
1⃣ why didn't you appear on the Razzaghi paper using your data?
2⃣ is your data synthetic?
3⃣ what is the binomial probability that 18/20 of a university's research team come from a group that comprises 2% of the US population, if all groups are equal? Image
Image
@jsm2334 For those confused... The original thread on #OHDSI - the data curators claiming an impossible 96% efficacy rate for a type-mismatched vaccine against infection - is here.

This is not their first rodeo in synthetic data

#EMRgate #Surgisphere

@jsm2334 And there we are.
Kevin Haynes confirming that @OHDSI is run by Johnson & Johnson (AKA Janssen).
youtube.com/watch?v=lEYmH0…
x.com/Jikkyleaks/sta…
Read 4 tweets
Nov 10, 2024
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 No. They have not monitored them. We have an FOI on this
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 TGA FOI 5274. Refused.
(part 1 of 2).

The TGA has no idea how many miscarriages occurred after COVID vaccination because they had no interest.

Their only interest is in protecting their income stream and the Bollinger.

@SenatorRennick @DrJulieSladden @BroadbentMP Image
Image
Image
Image
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 @SenatorRennick @DrJulieSladden @BroadbentMP TGA FOI 5274. Refused.
(part 2 of 2).

No pharmacovigilance was performed.
The TGA lied.

#placentagate Image
Image
Image
Read 5 tweets
Nov 7, 2024
Are you looking for this @VaccineMole ?

Declared "BGH polyA" sequence (226bp): CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTG
CCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTAT
TCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGAT
GCGGTGGGCTCTATGG

Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC

So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...

jbc.org/article/S0021-…

I'll try and find the missing sequence
#SV40Gate #PlasmidGateImage
Image
@Kevin_McKernan @VaccineMole Add in a CMV promoter for good measure and perhaps a soupcon of cancer to boot.

THIS IS WHY YOU DO NOT PUT PLASMIDS INTO LIPID NANOPARTICLES AND TRANSFECT THEM INTO HUMANS.
pmc.ncbi.nlm.nih.gov/articles/PMC26…

x.com/Jikkyleaks/sta…
Here it is.
The Oxford plasmid.
"SpyTag" and "SnoopTag" and a CMV promoter with the moo cow equivalent of SV40 in the PolyA.

I'm sure it's just a coincidence.

#TagGate
@FeeRedfern @JesslovesMJK @double_christ
ncbi.nlm.nih.gov/nucleotide/KU3…
ncbi.nlm.nih.gov/nucleotide/KY9…
pubmed.ncbi.nlm.nih.gov/26781591/Image
Image
Read 7 tweets
Aug 10, 2024
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
@DiedSuddenly_ Addendum: Some undeclared replication of images from the Jeon paper in 2022, same journal.
Jeon (left):
Lee (right):


@JesslovesMJK @Kevin_McKernan
#NanoGate ijvtpr.com/index.php/IJVT…
mail.ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄

#NanoGate Image
Read 4 tweets
Aug 10, 2024
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag

My view reading this is:

This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.

I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.Image
Image
Image
Image
@DiedSuddenly_ A bowling alley?

I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.

This was from 2022:


I wonder if they targeted Broudy to add some credence to the LARP. ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
Read 4 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Don't want to be a Premium member but still want to support us?

Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal

Or Donate anonymously using crypto!

Ethereum

0xfe58350B80634f60Fa6Dc149a72b4DFbc17D341E copy

Bitcoin

3ATGMxNzCUFzxpMCHL5sWSt4DVtS8UqXpi copy

Thank you for your support!

Follow Us!

:(