Yet the article written by @carey_alexis has some major red flags now.
In particular "not eligible for vaccination due to his age" and "no other confirmation of any teen deaths"
So, was 616124 ANOTHER death, or did Alexis Carey and John Couani lie?
Yet according to the DAEN, there were 193 COVID vaccine adverse event reports in 12-17 year olds (who were "not eligible") between the 1st August 2021 and 10th September 2021
Accounting for the delays in reporting to the DAEN (typically 1-2 weeks) from an event the drive to vaccinated the HSC students is consistent with the adverse event reports which took off on the 26th August and peaked at 23 reports IN ONE DAY.
So, are we to believe that Tom's death was a statistical anomaly - nothing to do with the huge Qudos mass vaccination drive and a completely coincidental tragic death a week later?
In one sense it would be better if these two deaths were not the same person. Because if they were, Carey, Couani @Lalalahna and other senior reporters would have colluded to cover up a story from which other children died as a result.
And if they are not the same person, why did the TGA not declare that a 17 year old had died of myocarditis (the "viral" label is misleading - viral or drug-induced myocarditis may look the same on histopathology) within weeks of a Pfizer vaccine?
As well as these other deaths.
One last thing. The eagle-eyed of you will have noticed in the graphic (h/t @SharonC59122606) that batch FP1430 resulted in a death of a 10 year old boy reported 6th May.
The batch continued to be used and a 5 year old boy died. Reported 10th May.
@jsm2334 I have 3 new questions:
1⃣ why didn't you appear on the Razzaghi paper using your data?
2⃣ is your data synthetic?
3⃣ what is the binomial probability that 18/20 of a university's research team come from a group that comprises 2% of the US population, if all groups are equal?
@jsm2334 For those confused... The original thread on #OHDSI - the data curators claiming an impossible 96% efficacy rate for a type-mismatched vaccine against infection - is here.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1