Jikkyleaks 🐭 Profile picture
Jan 5, 2023 19 tweets 9 min read Read on X
BREAKING CHEESE 🧀🧀🧀
#humpgate #TGAgate

1⃣ We found the humps.
2⃣ the EMA knew about them
3⃣ the analysis appears to be synthetic

@chrismartenson @stkirsch @Daoyu15 @Kevin_McKernan
Just a reminder that these are the same humps that we found in the TGA batch analyses here

They are contaminants at 3000nt and 2000nt length. The main mRNA should be about 4000nt length.
The EMA knew about these humps because they had them analysed. But only to a point.

Not only did they ONLY perform on analysis on the assumption of what they THOUGHT was in the product, but they accepted what now appear to be synthetic Western blots as evidence.
Here is the full document
files.catbox.moe/sg745z.pdf

The analysis was done by the Swedish Medical Products agency.
lakemedelsverket.se/sv
So someone spotted the humps that I also found and decided to separate them out from the main spike.

"Peak 1" is the non-spike RNA
"Peak 2" is the spike RNA
According to their analysis, the additional RNA had the 5'cap (which is the start of the RNA) but missed the end (the poly-A tail)

So it looked like it was broken fragments of the main RNA - but only the first part.

Where was the second part?
The whole fragment is 4284nt long. So if there is a 3000nt fragment with a 5'cap (with no poly A tail) there should be a 1284nt fragment floating around with a polyA tail!

Think of it like a lizard losing it's tail...
So what did they do to investigate this? Well, they assumed it must be spike RNA and therefore ran some Western blots (looking for protein) looking for spike protein fragments.

They showed that you need both the 5'cap and the polyA to produce the protein...
These are supposed to be Western blots with antibody staining each section of the spike protein (S1 and S2).

These showed that you need both ends to make spike.

You don't always need a polyA tail to make protein but OK, let's accept this.
Now they do the Western for Peak 1 (non-spike) and Peak 2 (spike) and stain with spike antibody.

The non-spike (peak 1) doesn't stain in either sample.

This means either it is not producing spike protein fragments, OR IT IS PRODUCING ANOTHER PROTEIN. Western blot as described in the document. Each black line i
In fact the document specifically requested "to further characterise the truncated and modified mRNA species present"

It's not just me.

Of course, that never happened. The only way to characterise these RNA fragments is by sequencing, and it has not been done.
So, to recap at this point we have:
1⃣aberrant mRNA at 3000nt and 2000nt, which cannot be a broken spike (4000nt)
2⃣those mRNA do NOT code for spike
3⃣no sequencing has been done to characterise the mRNA.
4⃣the fragments have 5' caps and are therefore active
Now the worst bit (as if the rest wasn't bad enough)...

Those Westerns are not right.

Here's what normal Westerns look like (this is from the same document). They are gels so they contract randomly, which is why nothing is ever a straight line.
(I'm not even going to start on the many different spike fragments in that gel).

Here are some more examples.

Note the typical features:
▶️Not straight lines
▶️Bleeding
▶️Rounded edges
▶️Uneven lines/bars
Now let's look at the first gel picture in the document "from the sponsor"

It's the straightest gel ever.

Not just that....
But look how regular and symmetrical these bands are.

It's impossible.
It even contradicts their own gel in figure 8.

And the document itself is dithered which means...
The EMA have the original hi-res document with pictures and they copied it with dithering to black-and-white to obfuscate any attempts at assessing the probity of the gels.

Just to push the point, this is what happens when you synthesise an image like this with dithering.
So the Westerns appear to be totally fabricated. I'm happy to be proven wrong on this.

My guess is that the EMA or the Swedish medicines agency know that there is something else in that product, and it isn't degraded spike.

Oh well. Russian roulette it is.
h/t to @JM125reasons for providing this important document

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Jikkyleaks 🐭

Jikkyleaks 🐭 Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @Jikkyleaks

Nov 10
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 No. They have not monitored them. We have an FOI on this
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 TGA FOI 5274. Refused.
(part 1 of 2).

The TGA has no idea how many miscarriages occurred after COVID vaccination because they had no interest.

Their only interest is in protecting their income stream and the Bollinger.

@SenatorRennick @DrJulieSladden @BroadbentMP Image
Image
Image
Image
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 @SenatorRennick @DrJulieSladden @BroadbentMP TGA FOI 5274. Refused.
(part 2 of 2).

No pharmacovigilance was performed.
The TGA lied.

#placentagate Image
Image
Image
Read 5 tweets
Nov 7
Are you looking for this @VaccineMole ?

Declared "BGH polyA" sequence (226bp): CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTG
CCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTAT
TCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGAT
GCGGTGGGCTCTATGG

Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC

So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...

jbc.org/article/S0021-…

I'll try and find the missing sequence
#SV40Gate #PlasmidGateImage
Image
@Kevin_McKernan @VaccineMole Add in a CMV promoter for good measure and perhaps a soupcon of cancer to boot.

THIS IS WHY YOU DO NOT PUT PLASMIDS INTO LIPID NANOPARTICLES AND TRANSFECT THEM INTO HUMANS.
pmc.ncbi.nlm.nih.gov/articles/PMC26…

x.com/Jikkyleaks/sta…
Here it is.
The Oxford plasmid.
"SpyTag" and "SnoopTag" and a CMV promoter with the moo cow equivalent of SV40 in the PolyA.

I'm sure it's just a coincidence.

#TagGate
@FeeRedfern @JesslovesMJK @double_christ
ncbi.nlm.nih.gov/nucleotide/KU3…
ncbi.nlm.nih.gov/nucleotide/KY9…
pubmed.ncbi.nlm.nih.gov/26781591/Image
Image
Read 7 tweets
Aug 10
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
@DiedSuddenly_ Addendum: Some undeclared replication of images from the Jeon paper in 2022, same journal.
Jeon (left):
Lee (right):


@JesslovesMJK @Kevin_McKernan
#NanoGate ijvtpr.com/index.php/IJVT…
mail.ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄

#NanoGate Image
Read 4 tweets
Aug 10
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag

My view reading this is:

This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.

I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.Image
Image
Image
Image
@DiedSuddenly_ A bowling alley?

I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.

This was from 2022:


I wonder if they targeted Broudy to add some credence to the LARP. ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
Read 4 tweets
Jun 16
@SenatorRennick The #3tablets protocols and #midazolam murders were the primary drivers of "COVID" death prior to the GMO rollout.

The publishers, who remain nameless, should be called to give evidence.covid19evidence.net.au
What in the holy hell?

The website which was used to propagandise the treatment of COVID during 2020-2024, and withhold effective treatments from people who then died..

Is now an air freight site.

THIS IS WHY WE ARCHIVE.

@tonynikolic10 @BroadbentMPcovid19evidence.net.auImage
https://archive.is/dEBZ1
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.

It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law
archive.is/dEBZ1
Read 4 tweets
Jan 25
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.

It's like Georgia. Someone flood the polling station quick! Image
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.

The problem is that they now have 19 hours to keep the bots going.

@elonmusk please make poll voting a 2-step interaction. TY.
Image
Image
Read 9 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Don't want to be a Premium member but still want to support us?

Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal

Or Donate anonymously using crypto!

Ethereum

0xfe58350B80634f60Fa6Dc149a72b4DFbc17D341E copy

Bitcoin

3ATGMxNzCUFzxpMCHL5sWSt4DVtS8UqXpi copy

Thank you for your support!

Follow Us!

:(