Jikkyleaks 🐭 Profile picture
Jan 17, 2023 19 tweets 10 min read Read on X
New Cheese 🧀🧀🧀on #Blotgate - The emerging scandal that keeps on giving.
The EMA and FDA reviews of the Pfizer BNT162b2 molecular biology assays were not independent reviews at all.
Pfizer wrote their documents.
@chrismartenson

The paper that David is referring to is published as a "peer reviewed" paper in @JPharmSciences

Except it wasn't that at all, it was a submission by Pfizer in response to the EMA and FDA questions posed in relation to their gene therapy product.
[PDF: jpharmsci.org/action/showPdf…]
It has simply been reconstituted as a "peer reviewed" manuscript.

These are the claims in the paper but they are not shown to be true.

Let's ignore the "safe and effective" claim for obvious reasons
The claims are that
(1) the mRNA has been isolated and characterized.

This is not true as no sequencing has been performed on the mRNA - the same mRNA "extras" identified in #humpgate

These humps with big red arrows
@Kevin_McKernan
and (2) that no additional (off-target) proteins are made because the mRNA that is in the product is truncated and unable to produce a protein product.

Again, not true based on this published data.
We saw this in #blotgate
So this paper - just published in January 2023 - is the exact same document as in the submissions to the EMA and FDA seen in the earlier threads.

Here is the #humpgate graph - the exact same one as the EMA document.
And the comedy Western blots are also the same. These as we saw are not Western blots at all but AWBs or "virtual blots". These are computer reconstructions that are easy to fake.

That's why papers are not normally accepted just based on AWBs.

This one was.
Those blots are meant to show that no other protein is made but simply show that no truncated spike protein is made (because they were only looking for spike protein fragments).

They did NOT exclude a different protein altogether.
There was in fact one genuine-looking Western blot in the whole paper, that was meant to show that no other proteins were being produced.

This one: https://jpharmsci.org/article/S0022-3549(23)00009-6/fulltextEMA Type II group of variations assessment report EMEA/H/C/0
The only problem is that the negative and positive controls were not specified, and there was only ever one of these produced - from one "special" batch not seen anywhere else.

They were meant to repeat this with 3 more batches. They didn't
So who was it exactly that produced this "peer reviewed paper"?

It was a Pfizerfest.
All Pfizer employees. Every single one.
The first author, Himakshi K Patel has no history on pubmed.gov so likely doesn't have a PhD.
The supervising author, Thomas F Lerch had a handful of first author papers prior to moving to Pfizer.

There are no university affiliations at all and no independent oversight of this paper.

pubmed.ncbi.nlm.nih.gov/?term=lerch%2C…
Which means that Pfizer wrote their own holiday brochure.

Nobody checked the hotel.
And it's not just me - the EMA said they need to "further characterize the mRNA" in July 2021.

No further characterisations were done.
We said so, so it's true.

The paper was published in January 2023.
Which is interesting, because this paper was approved on the day of the submission of the revised document.

Which was two days after we first exposed #humpgate

What are the odds?
Of course, you should trust Pfizer to make the product, investigate the product, write the assessors' brochure for the product and monitor their own clinical trial for the product.

Why wouldn't you?
justice.gov/opa/pr/justice…

@JesslovesMJK @MidwesternDoc
For reference this is the EMA document
files.catbox.moe/sg745z.pdf

And here is the Pfizer (BioNtech) FDA response document
files.catbox.moe/egah0n.pdf

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Jikkyleaks 🐭

Jikkyleaks 🐭 Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @Jikkyleaks

Nov 10
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 No. They have not monitored them. We have an FOI on this
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 TGA FOI 5274. Refused.
(part 1 of 2).

The TGA has no idea how many miscarriages occurred after COVID vaccination because they had no interest.

Their only interest is in protecting their income stream and the Bollinger.

@SenatorRennick @DrJulieSladden @BroadbentMP Image
Image
Image
Image
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 @SenatorRennick @DrJulieSladden @BroadbentMP TGA FOI 5274. Refused.
(part 2 of 2).

No pharmacovigilance was performed.
The TGA lied.

#placentagate Image
Image
Image
Read 5 tweets
Nov 7
Are you looking for this @VaccineMole ?

Declared "BGH polyA" sequence (226bp): CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTG
CCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTAT
TCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGAT
GCGGTGGGCTCTATGG

Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC

So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...

jbc.org/article/S0021-…

I'll try and find the missing sequence
#SV40Gate #PlasmidGateImage
Image
@Kevin_McKernan @VaccineMole Add in a CMV promoter for good measure and perhaps a soupcon of cancer to boot.

THIS IS WHY YOU DO NOT PUT PLASMIDS INTO LIPID NANOPARTICLES AND TRANSFECT THEM INTO HUMANS.
pmc.ncbi.nlm.nih.gov/articles/PMC26…

x.com/Jikkyleaks/sta…
Here it is.
The Oxford plasmid.
"SpyTag" and "SnoopTag" and a CMV promoter with the moo cow equivalent of SV40 in the PolyA.

I'm sure it's just a coincidence.

#TagGate
@FeeRedfern @JesslovesMJK @double_christ
ncbi.nlm.nih.gov/nucleotide/KU3…
ncbi.nlm.nih.gov/nucleotide/KY9…
pubmed.ncbi.nlm.nih.gov/26781591/Image
Image
Read 7 tweets
Aug 10
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
@DiedSuddenly_ Addendum: Some undeclared replication of images from the Jeon paper in 2022, same journal.
Jeon (left):
Lee (right):


@JesslovesMJK @Kevin_McKernan
#NanoGate ijvtpr.com/index.php/IJVT…
mail.ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄

#NanoGate Image
Read 4 tweets
Aug 10
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag

My view reading this is:

This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.

I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.Image
Image
Image
Image
@DiedSuddenly_ A bowling alley?

I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.

This was from 2022:


I wonder if they targeted Broudy to add some credence to the LARP. ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
Read 4 tweets
Jun 16
@SenatorRennick The #3tablets protocols and #midazolam murders were the primary drivers of "COVID" death prior to the GMO rollout.

The publishers, who remain nameless, should be called to give evidence.covid19evidence.net.au
What in the holy hell?

The website which was used to propagandise the treatment of COVID during 2020-2024, and withhold effective treatments from people who then died..

Is now an air freight site.

THIS IS WHY WE ARCHIVE.

@tonynikolic10 @BroadbentMPcovid19evidence.net.auImage
https://archive.is/dEBZ1
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.

It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law
archive.is/dEBZ1
Read 4 tweets
Jan 25
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.

It's like Georgia. Someone flood the polling station quick! Image
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.

The problem is that they now have 19 hours to keep the bots going.

@elonmusk please make poll voting a 2-step interaction. TY.
Image
Image
Read 9 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Don't want to be a Premium member but still want to support us?

Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal

Or Donate anonymously using crypto!

Ethereum

0xfe58350B80634f60Fa6Dc149a72b4DFbc17D341E copy

Bitcoin

3ATGMxNzCUFzxpMCHL5sWSt4DVtS8UqXpi copy

Thank you for your support!

Follow Us!

:(