For those enquiring about whether hospital episode statistics confirm an increase in miscarriages... the data is early.
NHS data only goes up to March 2022.
It's massively confounded but read on.
Here is "bleeding in early pregnancy" (O20)
7-sigma increase
NHS episode statistic 2017-2022:
"Maternal care for fetal problems"
ICD code O36. 4.7 sigma increase
There are others, e.g. diabetes (7.1 sigma increase)
But there are two codes which behave very oddly, that based on the other codes you would expect a rise but are either the same or lower number of episodes.
There is an explanation so hold on...
Here is "spontaneous abortion" aka miscarriage.
The miscarriages are higher than the previous year (when there were more pregnancies) but lower than the previous years.
What's going on?
Why did miscarriages fall so dramatically in 2020?
The clue lies in O04 - complications of induced abortion. These *halved* suddenly in 2020. Why?
In 2020, the same NHS who told you to stay at home if you had pneumonia also told you to keep out of the hospital for your abortion.
Where abortion care moved to the community it did not generate a hospital episode, so the number of hospital episodes went down.
Good luck getting the information on miscarriage numbers outside of hospital since 2020. Conveniently the ONS "do not hold this information" ons.gov.uk/aboutus/transp…
So all we can say is that under the likely same circumstances, hospital managed miscarriages are 5% up on the previous year, and we do not know how many were managed in the community.
We can try and adjust for the drop in 2020 which would look a bit like this...
What we can say though is that many of the complications of #pregnancy that must be managed in hospital, such as ectopic pregnancy, have increases that are unprecedented (7-sigma).
Despite a drop in birth numbers.
That's a massive safety signal.
And remember that most of the COVID vaccinations given in pregnancy were in the 2nd-3rd trimester, where they don't influence miscarriage rates.
A *doubling* of the miscarriage rate from 10% to 20% in 10% of pregnancies would give a graph that looked something like...
Yep.
And even without adjusting for community cases, if 5% of women received a COVID vaccine in the first trimester and the miscarriage rate doubled from 5% to 10% you would get a 5% rise from the previous year's numbers.
Exactly the figure seen (see ALT text for calculation)
Source for the above all taken from NHS digital hospital admitted care activity:
@SECGov @Kevin_McKernan @SabinehazanMD Wow so this company is claiming influence with 11,000 scientists and multiple links lead back to pharma and the gene therapy corporations.
Broad institute. Who could have guessed?
#pubpeergate
@Yale could be up to their necks in the biggest HIPAA scandal since @UChicago
This is how the scam appears to have worked.
Harlan Krumholz owns a patent for managing health data through an app. "Hugo health" was the middle man providing the app to bait people claiming to be vaccine injured to join a study called LISTEN. But it was essentially being run on behalf of Pfizer/Janssen who paid him $3m in "research grants".
Thousands of injured signed up but only 241 patients were used in the "study" of which the publications were irrelevant and showed nothing other than "the vaccines saved millions of lives" bla bla. Nothing helpful for the vaccine injured at all.
But the bombshell - the data that they provided was able to be sold off to anyone they wanted to. It was in the consent form that most people didn't read. The data was held on hugo.health which has now gone. It was NOT HIPAA compliant.
How did we know that hugo.health's servers were not HIPAA compliant?
Yale told the participants in a email in July 2024 (attached).
So where did all that health data go?
Was it sold off to the highest bidder or used in a blackmail campaign against vulnerable people who were vaccine injured and couldn't work? (Like those that have targeted our accounts recently)
We don't know. But you can be damn sure that Yale knows, and took secret action to remedy the situation having already taken millions of dollars from pharma to run studies that undermined the vaccine injured.
That is why there is so much animosity suddenly being directed at the vaccine injured. They want to bury this story.
Yale could be in very big trouble.
They deserve a hashtag.
#YaleGate
@Yale @UChicago For those confused, please understand what a "limited hangout" is here. While you are rejoicing on the scraps of Daily Mail fodder, the pharma companies' new narrative is enshrined by those very articles.
@jsm2334 I have 3 new questions:
1⃣ why didn't you appear on the Razzaghi paper using your data?
2⃣ is your data synthetic?
3⃣ what is the binomial probability that 18/20 of a university's research team come from a group that comprises 2% of the US population, if all groups are equal?
@jsm2334 For those confused... The original thread on #OHDSI - the data curators claiming an impossible 96% efficacy rate for a type-mismatched vaccine against infection - is here.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...