Jikkyleaks 🐭 Profile picture
Mar 1, 2023 14 tweets 7 min read Read on X
New cheese 🧀🧀🧀

For those enquiring about whether hospital episode statistics confirm an increase in miscarriages... the data is early.
NHS data only goes up to March 2022.

It's massively confounded but read on.

Here is "bleeding in early pregnancy" (O20)
7-sigma increase
NHS episode statistics 2017-2022:
"Ectopic pregnancy" ICD code O00.
7 sigma increase.
NHS episode statistic 2017-2022:
"Maternal care for fetal problems"
ICD code O36.
4.7 sigma increase

There are others, e.g. diabetes (7.1 sigma increase)
But there are two codes which behave very oddly, that based on the other codes you would expect a rise but are either the same or lower number of episodes.

There is an explanation so hold on...
Here is "spontaneous abortion" aka miscarriage.
The miscarriages are higher than the previous year (when there were more pregnancies) but lower than the previous years.

What's going on?

Why did miscarriages fall so dramatically in 2020?
The clue lies in O04 - complications of induced abortion. These *halved* suddenly in 2020. Why?

In 2020, the same NHS who told you to stay at home if you had pneumonia also told you to keep out of the hospital for your abortion.
Where abortion care moved to the community it did not generate a hospital episode, so the number of hospital episodes went down.

The same with miscarriages.
pubmed.ncbi.nlm.nih.gov/33893642/
Good luck getting the information on miscarriage numbers outside of hospital since 2020. Conveniently the ONS "do not hold this information"
ons.gov.uk/aboutus/transp…
So all we can say is that under the likely same circumstances, hospital managed miscarriages are 5% up on the previous year, and we do not know how many were managed in the community.

We can try and adjust for the drop in 2020 which would look a bit like this... Years 2020-2021 and 2021-2022 data has been adjusted upwards
What we can say though is that many of the complications of #pregnancy that must be managed in hospital, such as ectopic pregnancy, have increases that are unprecedented (7-sigma).

Despite a drop in birth numbers.

That's a massive safety signal.
And remember that most of the COVID vaccinations given in pregnancy were in the 2nd-3rd trimester, where they don't influence miscarriage rates.

A *doubling* of the miscarriage rate from 10% to 20% in 10% of pregnancies would give a graph that looked something like...

Yep.
And even without adjusting for community cases, if 5% of women received a COVID vaccine in the first trimester and the miscarriage rate doubled from 5% to 10% you would get a 5% rise from the previous year's numbers.

Exactly the figure seen (see ALT text for calculation) NHS total pregnancies are around 600,000 per year registered
Source for the above all taken from NHS digital hospital admitted care activity:

@ClareCraigPath @joshg99 @MartinNeil9 @RealJoelSmalley @EthicalSkeptic @boriquagato
digital.nhs.uk/data-and-infor…

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Jikkyleaks 🐭

Jikkyleaks 🐭 Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @Jikkyleaks

Apr 18
Please understand how important this is.

Two major papers showed that the COVID vaccine spike protein causes cancer by suppression of p53.

The authors of both have been threatened into retracting their papers by pharma groups tied to the NIH.

That's why it's called #NIHgate
Read 8 tweets
Apr 17
Imagine a company so large that they can recruit thousands of "experts" yet you've never heard of them.

And imagine that those recruited scientists include agents of #PubpeerGate whose job is to silence other scientists.

@secgov @Kevin_McKernan @SabinehazanMD Image
@SECGov @Kevin_McKernan @SabinehazanMD Wow so this company is claiming influence with 11,000 scientists and multiple links lead back to pharma and the gene therapy corporations.

Broad institute. Who could have guessed?
#pubpeergate

putassoc.com/about-us/meet-…Image
Image
Image
Image
Inizio aka Inizio Putnam aka PHMR - the largest company you have never heard of.

Why?
They don't want you to know they are the chief influencers to indoctrinate doctors and the public into accepting failed pharma products.

putassoc.com/our-expertise/…
Read 6 tweets
Feb 23
WHOA!!! 🧀

@Yale could be up to their necks in the biggest HIPAA scandal since @UChicago

This is how the scam appears to have worked.

Harlan Krumholz owns a patent for managing health data through an app. "Hugo health" was the middle man providing the app to bait people claiming to be vaccine injured to join a study called LISTEN. But it was essentially being run on behalf of Pfizer/Janssen who paid him $3m in "research grants".

Thousands of injured signed up but only 241 patients were used in the "study" of which the publications were irrelevant and showed nothing other than "the vaccines saved millions of lives" bla bla. Nothing helpful for the vaccine injured at all.

But the bombshell - the data that they provided was able to be sold off to anyone they wanted to. It was in the consent form that most people didn't read. The data was held on hugo.health which has now gone. It was NOT HIPAA compliant.

How did we know that hugo.health's servers were not HIPAA compliant?

Yale told the participants in a email in July 2024 (attached).

So where did all that health data go?

Was it sold off to the highest bidder or used in a blackmail campaign against vulnerable people who were vaccine injured and couldn't work? (Like those that have targeted our accounts recently)

We don't know. But you can be damn sure that Yale knows, and took secret action to remedy the situation having already taken millions of dollars from pharma to run studies that undermined the vaccine injured.

That is why there is so much animosity suddenly being directed at the vaccine injured. They want to bury this story.

Yale could be in very big trouble.
They deserve a hashtag.
#YaleGate

@RobertKennedyJr @SECGov @AGHuff @chrismartenson

Patent:
patents.justia.com/inventor/harla…
Pubmed showing over 1000 papers (not possible for a clinician researcher writing his own papers):
pubmed.ncbi.nlm.nih.gov/?term=krumholz…
LISTEN studies:
pubmed.ncbi.nlm.nih.gov/?term=krumholz…Image
Image
Image
@Yale @UChicago For those confused, please understand what a "limited hangout" is here. While you are rejoicing on the scraps of Daily Mail fodder, the pharma companies' new narrative is enshrined by those very articles.

"Injuries are very rare but it was worth it"

Getting more information about this pharma honeypot.

$2m to Iwasaki.

How much more pharmaceutical net went into this group to push boosters?

Image
Read 5 tweets
Dec 12, 2024
@jsm2334 I have 3 new questions:
1⃣ why didn't you appear on the Razzaghi paper using your data?
2⃣ is your data synthetic?
3⃣ what is the binomial probability that 18/20 of a university's research team come from a group that comprises 2% of the US population, if all groups are equal? Image
Image
@jsm2334 For those confused... The original thread on #OHDSI - the data curators claiming an impossible 96% efficacy rate for a type-mismatched vaccine against infection - is here.

This is not their first rodeo in synthetic data

#EMRgate #Surgisphere

@jsm2334 And there we are.
Kevin Haynes confirming that @OHDSI is run by Johnson & Johnson (AKA Janssen).
youtube.com/watch?v=lEYmH0…
x.com/Jikkyleaks/sta…
Read 4 tweets
Nov 10, 2024
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 No. They have not monitored them. We have an FOI on this
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 TGA FOI 5274. Refused.
(part 1 of 2).

The TGA has no idea how many miscarriages occurred after COVID vaccination because they had no interest.

Their only interest is in protecting their income stream and the Bollinger.

@SenatorRennick @DrJulieSladden @BroadbentMP Image
Image
Image
Image
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 @SenatorRennick @DrJulieSladden @BroadbentMP TGA FOI 5274. Refused.
(part 2 of 2).

No pharmacovigilance was performed.
The TGA lied.

#placentagate Image
Image
Image
Read 5 tweets
Nov 7, 2024
Are you looking for this @VaccineMole ?

Declared "BGH polyA" sequence (226bp): CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTG
CCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTAT
TCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGAT
GCGGTGGGCTCTATGG

Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC

So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...

jbc.org/article/S0021-…

I'll try and find the missing sequence
#SV40Gate #PlasmidGateImage
Image
@Kevin_McKernan @VaccineMole Add in a CMV promoter for good measure and perhaps a soupcon of cancer to boot.

THIS IS WHY YOU DO NOT PUT PLASMIDS INTO LIPID NANOPARTICLES AND TRANSFECT THEM INTO HUMANS.
pmc.ncbi.nlm.nih.gov/articles/PMC26…

x.com/Jikkyleaks/sta…
Here it is.
The Oxford plasmid.
"SpyTag" and "SnoopTag" and a CMV promoter with the moo cow equivalent of SV40 in the PolyA.

I'm sure it's just a coincidence.

#TagGate
@FeeRedfern @JesslovesMJK @double_christ
ncbi.nlm.nih.gov/nucleotide/KU3…
ncbi.nlm.nih.gov/nucleotide/KY9…
pubmed.ncbi.nlm.nih.gov/26781591/Image
Image
Read 7 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Don't want to be a Premium member but still want to support us?

Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal

Or Donate anonymously using crypto!

Ethereum

0xfe58350B80634f60Fa6Dc149a72b4DFbc17D341E copy

Bitcoin

3ATGMxNzCUFzxpMCHL5sWSt4DVtS8UqXpi copy

Thank you for your support!

Follow Us!

:(