For those enquiring about whether hospital episode statistics confirm an increase in miscarriages... the data is early.
NHS data only goes up to March 2022.
It's massively confounded but read on.
Here is "bleeding in early pregnancy" (O20)
7-sigma increase
NHS episode statistic 2017-2022:
"Maternal care for fetal problems"
ICD code O36. 4.7 sigma increase
There are others, e.g. diabetes (7.1 sigma increase)
But there are two codes which behave very oddly, that based on the other codes you would expect a rise but are either the same or lower number of episodes.
There is an explanation so hold on...
Here is "spontaneous abortion" aka miscarriage.
The miscarriages are higher than the previous year (when there were more pregnancies) but lower than the previous years.
What's going on?
Why did miscarriages fall so dramatically in 2020?
The clue lies in O04 - complications of induced abortion. These *halved* suddenly in 2020. Why?
In 2020, the same NHS who told you to stay at home if you had pneumonia also told you to keep out of the hospital for your abortion.
Where abortion care moved to the community it did not generate a hospital episode, so the number of hospital episodes went down.
Good luck getting the information on miscarriage numbers outside of hospital since 2020. Conveniently the ONS "do not hold this information" ons.gov.uk/aboutus/transp…
So all we can say is that under the likely same circumstances, hospital managed miscarriages are 5% up on the previous year, and we do not know how many were managed in the community.
We can try and adjust for the drop in 2020 which would look a bit like this...
What we can say though is that many of the complications of #pregnancy that must be managed in hospital, such as ectopic pregnancy, have increases that are unprecedented (7-sigma).
Despite a drop in birth numbers.
That's a massive safety signal.
And remember that most of the COVID vaccinations given in pregnancy were in the 2nd-3rd trimester, where they don't influence miscarriage rates.
A *doubling* of the miscarriage rate from 10% to 20% in 10% of pregnancies would give a graph that looked something like...
Yep.
And even without adjusting for community cases, if 5% of women received a COVID vaccine in the first trimester and the miscarriage rate doubled from 5% to 10% you would get a 5% rise from the previous year's numbers.
Exactly the figure seen (see ALT text for calculation)
Source for the above all taken from NHS digital hospital admitted care activity:
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.
It's like Georgia. Someone flood the polling station quick!
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.
The problem is that they now have 19 hours to keep the bots going.
@elonmusk please make poll voting a 2-step interaction. TY.