Share this page!

Enter URL or ID to Unroll

You can paste full URL like: https://x.com/threadreaderapp/status/1644127596119195649
or just the ID like: 1644127596119195649

How to get URL link on X (Twitter) App

  1. On the Twitter thread, click on or icon on the bottom
  2. Click again on or Share Via icon
  3. Click on Copy Link to Tweet
  4. Paste it above and click "Unroll Thread"!
  5. More info at Twitter Help
Jikkyleaks 🐭 Profile picture
@Jikkyleaks
May 22, 2023 • 12 tweets • 8 min read • Read on X
Scrolly
🧵
What is the probability that .@sarahjestock - who is the Program Director of @WellcomeLeap - should be randomly the corresponding author on a paper that she didn't write, relating to datasets that can't be audited, showing "no pregnancy problems with mRNA vaccines"?
And what is the probability that @sarahjestock has written 50 papers in 2 years whilst being a full time obstetrician, university professor at two universities, program director at @WellcomeLeap...

And in her papers declares no conflicts of interest...

pubmed.ncbi.nlm.nih.gov/?term=stock%2C…
Except when she declares conflicts of interest.

It's hit and miss, you see. When it's a pregnancy in vaccine paper there are no conflicts of interest. When it's another paper, we'll declare them but they aren't really conflicts because they are just Pharma so that's fine ImageImage
And can you believe it? Sarah Stock - whose name is on over 100 papers - just happened to team up with Colin Simpson in 2020!

What a coincidence!

And these are the two players behind the Scottish COVID vaccine in pregnancy data

pubmed.ncbi.nlm.nih.gov/?term=stock%2C… ImageImage
Ah... It's because you're not in Scotland any more, but apparently still curating the Scotland data sets for Sarah.

Nope, now you're in NZ.
And congratulations on your $41m research grant funding.

Oh but wait..
people.wgtn.ac.nz/colin.simpson
The HDRUK Impact of the Year award 2021?
Really?
They kept that quiet.
So you went from teacher's pet at Nicole Junkermann's and Matt Hancock's HDRUK...

@FeeRedfern @artisbrutal2021 ImageImage
Which is infamous for its links to Jeffrey Epstein via Nicole Junkermann https://johnnyvedmore.com/2...
To be in charge of New Zealand's Electronic Health Data.

Oh good. I'm sure New Zealanders can now sleep easy knowing that their health data is getting the "HDRUK" treatment and being pawned off to Pharma to create synthetic data sets to sell more drugs that don't work?
#EMRgate Image
And it's so pleasing to see such collaboration and obviously with all your awards it's understandable that you don't remember to declare your conflicts of interest. ImageImageImageImage
So let me ask you both this important question:

Did first author Clara Calvert analyse the 500,000+ patient data sets for those Nature papers, verify them and write the papers - or were they ghost written for her?

pubmed.ncbi.nlm.nih.gov/?term=stock%2C… Image
@RetsefL @VikiLovesFACS @joshg99 @ClareCraigPath @MartinNeil9 @profnfenton
In lay summary terms...

Wellcome (Pharma) and governments fund Universities to publish high impact papers showing that the vaccines were safe in pregnancy..

Using manipulated data that can't be verified - because you're not allowed to see it.
#placentagate

• • •

Missing some Tweet in this thread? You can try to force a refresh
　

Keep Current with Jikkyleaks 🐭

Jikkyleaks 🐭 Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @Jikkyleaks

Jikkyleaks 🐭 Profile picture
Apr 17
Imagine a company so large that they can recruit thousands of "experts" yet you've never heard of them.

And imagine that those recruited scientists include agents of #PubpeerGate whose job is to silence other scientists.

@secgov @Kevin_McKernan @SabinehazanMD Image
@SECGov @Kevin_McKernan @SabinehazanMD Wow so this company is claiming influence with 11,000 scientists and multiple links lead back to pharma and the gene therapy corporations.

Broad institute. Who could have guessed?
#pubpeergate

putassoc.com/about-us/meet-…Image
Image
Image
Image
Inizio aka Inizio Putnam aka PHMR - the largest company you have never heard of.

Why?
They don't want you to know they are the chief influencers to indoctrinate doctors and the public into accepting failed pharma products.

putassoc.com/our-expertise/…
Read 6 tweets
Jikkyleaks 🐭 Profile picture
Feb 23
WHOA!!! 🧀

@Yale could be up to their necks in the biggest HIPAA scandal since @UChicago

This is how the scam appears to have worked.

Harlan Krumholz owns a patent for managing health data through an app. "Hugo health" was the middle man providing the app to bait people claiming to be vaccine injured to join a study called LISTEN. But it was essentially being run on behalf of Pfizer/Janssen who paid him $3m in "research grants".

Thousands of injured signed up but only 241 patients were used in the "study" of which the publications were irrelevant and showed nothing other than "the vaccines saved millions of lives" bla bla. Nothing helpful for the vaccine injured at all.

But the bombshell - the data that they provided was able to be sold off to anyone they wanted to. It was in the consent form that most people didn't read. The data was held on hugo.health which has now gone. It was NOT HIPAA compliant.

How did we know that hugo.health's servers were not HIPAA compliant?

Yale told the participants in a email in July 2024 (attached).

So where did all that health data go?

Was it sold off to the highest bidder or used in a blackmail campaign against vulnerable people who were vaccine injured and couldn't work? (Like those that have targeted our accounts recently)

We don't know. But you can be damn sure that Yale knows, and took secret action to remedy the situation having already taken millions of dollars from pharma to run studies that undermined the vaccine injured.

That is why there is so much animosity suddenly being directed at the vaccine injured. They want to bury this story.

Yale could be in very big trouble.
They deserve a hashtag.
#YaleGate

@RobertKennedyJr @SECGov @AGHuff @chrismartenson

Patent:
patents.justia.com/inventor/harla…
Pubmed showing over 1000 papers (not possible for a clinician researcher writing his own papers):
pubmed.ncbi.nlm.nih.gov/?term=krumholz…
LISTEN studies:
pubmed.ncbi.nlm.nih.gov/?term=krumholz…Image
Image
Image
@Yale @UChicago For those confused, please understand what a "limited hangout" is here. While you are rejoicing on the scraps of Daily Mail fodder, the pharma companies' new narrative is enshrined by those very articles.

"Injuries are very rare but it was worth it"

Getting more information about this pharma honeypot.

$2m to Iwasaki.

How much more pharmaceutical net went into this group to push boosters?

Image
Read 5 tweets
Jikkyleaks 🐭 Profile picture
Dec 12, 2024
@jsm2334 I have 3 new questions:
1⃣ why didn't you appear on the Razzaghi paper using your data?
2⃣ is your data synthetic?
3⃣ what is the binomial probability that 18/20 of a university's research team come from a group that comprises 2% of the US population, if all groups are equal? Image
Image
@jsm2334 For those confused... The original thread on #OHDSI - the data curators claiming an impossible 96% efficacy rate for a type-mismatched vaccine against infection - is here.

This is not their first rodeo in synthetic data

#EMRgate #Surgisphere

@jsm2334 And there we are.
Kevin Haynes confirming that @OHDSI is run by Johnson & Johnson (AKA Janssen).
youtube.com/watch?v=lEYmH0…
x.com/Jikkyleaks/sta…
Read 4 tweets
Jikkyleaks 🐭 Profile picture
Nov 10, 2024
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 No. They have not monitored them. We have an FOI on this
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 TGA FOI 5274. Refused.
(part 1 of 2).

The TGA has no idea how many miscarriages occurred after COVID vaccination because they had no interest.

Their only interest is in protecting their income stream and the Bollinger.

@SenatorRennick @DrJulieSladden @BroadbentMP Image
Image
Image
Image
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 @SenatorRennick @DrJulieSladden @BroadbentMP TGA FOI 5274. Refused.
(part 2 of 2).

No pharmacovigilance was performed.
The TGA lied.

#placentagate Image
Image
Image
Read 5 tweets
Jikkyleaks 🐭 Profile picture
Nov 7, 2024
Are you looking for this @VaccineMole ?

Declared "BGH polyA" sequence (226bp): CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTG
CCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTAT
TCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGAT
GCGGTGGGCTCTATGG

Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC

So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...

jbc.org/article/S0021-…

I'll try and find the missing sequence
#SV40Gate #PlasmidGateImage
Image
@Kevin_McKernan @VaccineMole Add in a CMV promoter for good measure and perhaps a soupcon of cancer to boot.

THIS IS WHY YOU DO NOT PUT PLASMIDS INTO LIPID NANOPARTICLES AND TRANSFECT THEM INTO HUMANS.
pmc.ncbi.nlm.nih.gov/articles/PMC26…

x.com/Jikkyleaks/sta…
Here it is.
The Oxford plasmid.
"SpyTag" and "SnoopTag" and a CMV promoter with the moo cow equivalent of SV40 in the PolyA.

I'm sure it's just a coincidence.

#TagGate
@FeeRedfern @JesslovesMJK @double_christ
ncbi.nlm.nih.gov/nucleotide/KU3…
ncbi.nlm.nih.gov/nucleotide/KY9…
pubmed.ncbi.nlm.nih.gov/26781591/Image
Image
Read 7 tweets
Jikkyleaks 🐭 Profile picture
Aug 10, 2024
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
@DiedSuddenly_ Addendum: Some undeclared replication of images from the Jeon paper in 2022, same journal.
Jeon (left):
Lee (right):


@JesslovesMJK @Kevin_McKernan
#NanoGate ijvtpr.com/index.php/IJVT…
mail.ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄

#NanoGate Image
Read 4 tweets

Did Thread Reader help you today?

Support us! We are indie developers!

This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Don't want to be a Premium member but still want to support us?

Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal

Or Donate anonymously using crypto!

Ethereum

0xfe58350B80634f60Fa6Dc149a72b4DFbc17D341E copy

Bitcoin

3ATGMxNzCUFzxpMCHL5sWSt4DVtS8UqXpi copy

Thank you for your support!

Follow Us!

Send Email!

:(