Jikkyleaks 🐭 Profile picture
Jun 6, 2023 15 tweets 7 min read Read on X
💥💥💥BOOM 💥💥💥
🧀🧵

The stakes just went up massively in #GMCgate.

The #muttoncrew's @dr_barrett, a self-proclaimed "paediatric haematologist" just accused @DrAseemMalhotra of making a false claim over the Jorja Halliday case.

Big mistake
Image
Neil Barrett, who claims to be at @CHIatConnollym is a member of the #muttoncrew, the UK's famous "disinformation warriors" on twitter. He has a researchgate profile but that's where his trace ends.

He's a real doctor but no web presence.
Whether he is practising is unknown.
But now we have an interesting conundrum because Neil is claiming that Jorja Halliday's death was not vaccine related, even though she was certified as dying of "myocarditis" - "on the day she was due to receive her vaccine".
news.sky.com/story/sister-o…
Except the story doesn't fit because she supposedly died 4 days after testing positive for COVID.

Viral Myocarditis doesn't work like that, it appears later.

The largest COVID series shows a chronic or subacute disease.
pubmed.ncbi.nlm.nih.gov/33463366/
At worst this may produce cardiac failure down the track and in a young girl in a hospital without cardiac failure, there would be a myriad of options for support if she got it.

The story stinks.

@DrAseemMalhotra is a cardiologist and KNOWS how post-viral myocarditis works
So, where was Tracey Halliday?

Well Sky News portrayed Tracey as a single mother of 5 living in a council flat in the UK. The only time we see someone who could be her is in their photo. Image
In fact it's almost as if the media were trying to portray Tracey Halliday as the new Shannon Matthews
bbc.com/news/uk-388814… Image
And any search for Tracey Halliday or Jorja Halliday prior to September 2021 is more or less a dead end. Apart from spurious findings of make-up artists working with the media.

Obviously @TraceyJSpencer is nothing to do with this.
Far too posh. Image
Talking of posh. If Tracey Halliday is a council house mother of 5 as portrayed by Sky, how has her sister managed to get such a refined accent?

Almost like an actress in this ITV interview, but without the emotion.

How could you have no emotion here?
itv.com/news/meridian/…
It's worth watching this clip. These days a lot of medical school and medical college exams use actresses, and it looks like this. No emotion. Read from a script.

Why would this interview be so emotionless?
And the call for vaccination seems out of place.
Scripted.
So there is something very fishy about the story of Jorja's death.
I suspect it has to do with her care at @icu_portsmouth.

I asked this question of the lead clinician there.
Let's see what happens.
In the meantime I would welcome any updates from @laurabundock who was given the scoop, despite being a Royal Correspondent.

It now becomes imperative that the truth about Jorja Halliday's death is told. Because on the face of it it looks like someone is hiding something.
And the story really reminds me of the death of Adriana Takara, that we know to be a cover up of a terrible mistake resulting from the imposition of fear to coerce an experimental RNA therapy.

I really hope this isn't Jorja's story too.

arkmedic.substack.com/p/adriana-taka… Image
ITV interview archived
archive.is/kG2tJ
Tweet earlier should read
@CHIatConnolly

I have no idea where the extra "m" came from. 🤦

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Jikkyleaks 🐭

Jikkyleaks 🐭 Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @Jikkyleaks

Nov 10
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 No. They have not monitored them. We have an FOI on this
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 TGA FOI 5274. Refused.
(part 1 of 2).

The TGA has no idea how many miscarriages occurred after COVID vaccination because they had no interest.

Their only interest is in protecting their income stream and the Bollinger.

@SenatorRennick @DrJulieSladden @BroadbentMP Image
Image
Image
Image
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 @SenatorRennick @DrJulieSladden @BroadbentMP TGA FOI 5274. Refused.
(part 2 of 2).

No pharmacovigilance was performed.
The TGA lied.

#placentagate Image
Image
Image
Read 5 tweets
Nov 7
Are you looking for this @VaccineMole ?

Declared "BGH polyA" sequence (226bp): CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTG
CCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTAT
TCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGAT
GCGGTGGGCTCTATGG

Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC

So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...

jbc.org/article/S0021-…

I'll try and find the missing sequence
#SV40Gate #PlasmidGateImage
Image
@Kevin_McKernan @VaccineMole Add in a CMV promoter for good measure and perhaps a soupcon of cancer to boot.

THIS IS WHY YOU DO NOT PUT PLASMIDS INTO LIPID NANOPARTICLES AND TRANSFECT THEM INTO HUMANS.
pmc.ncbi.nlm.nih.gov/articles/PMC26…

x.com/Jikkyleaks/sta…
Here it is.
The Oxford plasmid.
"SpyTag" and "SnoopTag" and a CMV promoter with the moo cow equivalent of SV40 in the PolyA.

I'm sure it's just a coincidence.

#TagGate
@FeeRedfern @JesslovesMJK @double_christ
ncbi.nlm.nih.gov/nucleotide/KU3…
ncbi.nlm.nih.gov/nucleotide/KY9…
pubmed.ncbi.nlm.nih.gov/26781591/Image
Image
Read 7 tweets
Aug 10
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
@DiedSuddenly_ Addendum: Some undeclared replication of images from the Jeon paper in 2022, same journal.
Jeon (left):
Lee (right):


@JesslovesMJK @Kevin_McKernan
#NanoGate ijvtpr.com/index.php/IJVT…
mail.ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄

#NanoGate Image
Read 4 tweets
Aug 10
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag

My view reading this is:

This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.

I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.Image
Image
Image
Image
@DiedSuddenly_ A bowling alley?

I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.

This was from 2022:


I wonder if they targeted Broudy to add some credence to the LARP. ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
Read 4 tweets
Jun 16
@SenatorRennick The #3tablets protocols and #midazolam murders were the primary drivers of "COVID" death prior to the GMO rollout.

The publishers, who remain nameless, should be called to give evidence.covid19evidence.net.au
What in the holy hell?

The website which was used to propagandise the treatment of COVID during 2020-2024, and withhold effective treatments from people who then died..

Is now an air freight site.

THIS IS WHY WE ARCHIVE.

@tonynikolic10 @BroadbentMPcovid19evidence.net.auImage
https://archive.is/dEBZ1
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.

It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law
archive.is/dEBZ1
Read 4 tweets
Jan 25
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.

It's like Georgia. Someone flood the polling station quick! Image
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.

The problem is that they now have 19 hours to keep the bots going.

@elonmusk please make poll voting a 2-step interaction. TY.
Image
Image
Read 9 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Don't want to be a Premium member but still want to support us?

Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal

Or Donate anonymously using crypto!

Ethereum

0xfe58350B80634f60Fa6Dc149a72b4DFbc17D341E copy

Bitcoin

3ATGMxNzCUFzxpMCHL5sWSt4DVtS8UqXpi copy

Thank you for your support!

Follow Us!

:(