The #muttoncrew's @dr_barrett, a self-proclaimed "paediatric haematologist" just accused @DrAseemMalhotra of making a false claim over the Jorja Halliday case.
Neil Barrett, who claims to be at @CHIatConnollym is a member of the #muttoncrew, the UK's famous "disinformation warriors" on twitter. He has a researchgate profile but that's where his trace ends.
He's a real doctor but no web presence.
Whether he is practising is unknown.
But now we have an interesting conundrum because Neil is claiming that Jorja Halliday's death was not vaccine related, even though she was certified as dying of "myocarditis" - "on the day she was due to receive her vaccine". news.sky.com/story/sister-o…
Except the story doesn't fit because she supposedly died 4 days after testing positive for COVID.
Viral Myocarditis doesn't work like that, it appears later.
At worst this may produce cardiac failure down the track and in a young girl in a hospital without cardiac failure, there would be a myriad of options for support if she got it.
The story stinks.
@DrAseemMalhotra is a cardiologist and KNOWS how post-viral myocarditis works
So, where was Tracey Halliday?
Well Sky News portrayed Tracey as a single mother of 5 living in a council flat in the UK. The only time we see someone who could be her is in their photo.
In fact it's almost as if the media were trying to portray Tracey Halliday as the new Shannon Matthews bbc.com/news/uk-388814…
And any search for Tracey Halliday or Jorja Halliday prior to September 2021 is more or less a dead end. Apart from spurious findings of make-up artists working with the media.
Obviously @TraceyJSpencer is nothing to do with this.
Far too posh.
Talking of posh. If Tracey Halliday is a council house mother of 5 as portrayed by Sky, how has her sister managed to get such a refined accent?
Almost like an actress in this ITV interview, but without the emotion.
It's worth watching this clip. These days a lot of medical school and medical college exams use actresses, and it looks like this. No emotion. Read from a script.
Why would this interview be so emotionless?
And the call for vaccination seems out of place.
Scripted.
So there is something very fishy about the story of Jorja's death.
I suspect it has to do with her care at @icu_portsmouth.
I asked this question of the lead clinician there.
Let's see what happens.
In the meantime I would welcome any updates from @laurabundock who was given the scoop, despite being a Royal Correspondent.
It now becomes imperative that the truth about Jorja Halliday's death is told. Because on the face of it it looks like someone is hiding something.
And the story really reminds me of the death of Adriana Takara, that we know to be a cover up of a terrible mistake resulting from the imposition of fear to coerce an experimental RNA therapy.
@Yale could be up to their necks in the biggest HIPAA scandal since @UChicago
This is how the scam appears to have worked.
Harlan Krumholz owns a patent for managing health data through an app. "Hugo health" was the middle man providing the app to bait people claiming to be vaccine injured to join a study called LISTEN. But it was essentially being run on behalf of Pfizer/Janssen who paid him $3m in "research grants".
Thousands of injured signed up but only 241 patients were used in the "study" of which the publications were irrelevant and showed nothing other than "the vaccines saved millions of lives" bla bla. Nothing helpful for the vaccine injured at all.
But the bombshell - the data that they provided was able to be sold off to anyone they wanted to. It was in the consent form that most people didn't read. The data was held on hugo.health which has now gone. It was NOT HIPAA compliant.
How did we know that hugo.health's servers were not HIPAA compliant?
Yale told the participants in a email in July 2024 (attached).
So where did all that health data go?
Was it sold off to the highest bidder or used in a blackmail campaign against vulnerable people who were vaccine injured and couldn't work? (Like those that have targeted our accounts recently)
We don't know. But you can be damn sure that Yale knows, and took secret action to remedy the situation having already taken millions of dollars from pharma to run studies that undermined the vaccine injured.
That is why there is so much animosity suddenly being directed at the vaccine injured. They want to bury this story.
Yale could be in very big trouble.
They deserve a hashtag.
#YaleGate
@Yale @UChicago For those confused, please understand what a "limited hangout" is here. While you are rejoicing on the scraps of Daily Mail fodder, the pharma companies' new narrative is enshrined by those very articles.
@jsm2334 I have 3 new questions:
1⃣ why didn't you appear on the Razzaghi paper using your data?
2⃣ is your data synthetic?
3⃣ what is the binomial probability that 18/20 of a university's research team come from a group that comprises 2% of the US population, if all groups are equal?
@jsm2334 For those confused... The original thread on #OHDSI - the data curators claiming an impossible 96% efficacy rate for a type-mismatched vaccine against infection - is here.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.