Did you know that Pfizer (the "sponsor") manipulated images of spike protein in the nucleus when they submitted their shiny brochure to the @TGAgovau, and the TGA didn't care?
Check this out, thread to follow.
Here's the original plate
In the original plate (the one submitted to the TGA), you should be able to see that the S1 image shows a bright signal to the top left of the "two fried eggs"
The "fried eggs" are the nuclei, stained blue in the left column
Original plate again. Ignore the merge column.
In the left column the nuclei have a dark circle (like an egg yolk), which is the nucleolus.
In the S1 image the nuclei look bigger, which reduces the impact of the signal in the nucleus.
There should be NO GREEN in the nucleus
But there is green in the nucleus.
You can see it, but I've labelled it just in case
@JesslovesMJK
Now the twist.
Even scientists I know with lab experience didn't notice the nuclear staining in the Pfizer document until it was pointed out. Why?
Because the sponsor (Pfizer) pulled a trick.
They manipulated the brightness of the image.
Here's the original again
Now let's change the shadows and highlights of the whole plate in the same way and see if any of the subplates look different.
Bingo.
The S1 vaccinated plate background (and the merge) have been altered in comparison to the Hoechst plates.
So let's try and reverse this correction and see what we get
Well that looks pretty convincing.
The nucleus is flooded with green.
Because the spike protein is flooding the nucleus.
And if you're not convinced here is the corrected view against the original view.
Subtle, but enough for scientists at the TGA to say "nothing to see here, let's approve this and get our posh nosh"
@double_christ @TonyNikolic10
And you might ask..
"Why does it matter if the spike protein gets in the nucleus?"
Well, because it destroys the body's cancer defence mechanisms via suppression of p53, which is the body's main defence against cancer.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.
It's like Georgia. Someone flood the polling station quick!
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.
The problem is that they now have 19 hours to keep the bots going.
@elonmusk please make poll voting a 2-step interaction. TY.