Do you see how it works yet?
@UniofOxford make a mint pushing a failed and dangerous vaccine for a disease that they fraudulently promoted as lethal...
Whilst pretending to run studies that - if they could interfere with the gravy train - were never published.
(see next tweet)
Here is the clinical trials record for the Wellcome-sponsored COPCOV trial, which was the most likely to report a benefit of protection from #hydroxychloroquine.
Because the trial data was scrubbed.
Here is the ANZCTR record.
The trial website has gone, but previously existed.
https://t.co/cBh1xQw6iK https://t.co/iZRX49qvyvcovidshieldtrial.com.au anzctr.org.au/TrialSearch.as…
Did you catch it?
The smartest mice get the tastiest cheese.
Who has control of this trial?
Who registered the website?
Why our old friends @IQVIA_global of course.
The very people who procured the data for the "highly safe and effective"....
Astrazeneca COVID vaccine, for which they were the data collaborator (aka data maker)
And who were working in conjunction with @UniofOxford, home of our extremist #Vaxophile @trishgreenhalgh, to develop a vaccine... that killed untold numbers of people...
For a disease that was non-lethal in 99% of people and almost certainly treatable in the remainder, if the hydroxychloroquine (+ azithromycin) studies were allowed to have been published.
But @astrazeneca, @IQVIA and @UniofOxford made sure they weren't. Didn't they?
@AstraZeneca @IQVIA @UniofOxford And remember that this is the same IQVIA which has its tentacles in every EMR in every country, yet also ran the only lab in the world...
Where the PCR positive rate for COVID was 99.99%
I'm sure it was just a coincidence.
@MartinNeil9 @profnfenton
@AstraZeneca @IQVIA @UniofOxford @MartinNeil9 @profnfenton Once you realise the collusion between @UniofOxford, their pharma stooge @trishgreenhalgh, the corrupted PRINCIPLE trial and the lethal RECOVERY trial which were all run from the same place...
And remember the ironically-named RECOVERY trial which was also run out of Oxford using @bengoldacre's @HDR_UK pet project, supervised by Jeffrey Epstein's favourite Nicole Junkermann.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.
It's like Georgia. Someone flood the polling station quick!
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.
The problem is that they now have 19 hours to keep the bots going.
@elonmusk please make poll voting a 2-step interaction. TY.