Share this page!

Dr Adam Rutherford Profile picture
Twitter logo
21 Jan, 4 tweets, 1 min read
This callow actor casually slagging off physics teachers on the BBC is shameful, embarrassing, and anti-educational. It serves none of the BBC’s values.
I don't wish a pile on. But these stereotypes are damaging. It's stuff similar to this that tells girls they can't do physics, or that science is for nerds not cool kids.
These anti-intellectual stereotypes are why we have such cultural ignorance about scientific practice, which fuel conspiracy theories about climate change or vaccines, or pandemics.
You know who made the vaccine?

• • •

Missing some Tweet in this thread? You can try to force a refresh
　

Keep Current with Dr Adam Rutherford

Dr Adam Rutherford Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @AdamRutherford

Dr Adam Rutherford Profile picture
8 Jan
So here’s a question. The cosplay wieners who broke into the Capitol buildings and then, like wandered around. What did they *think* was going to happen? That Trump would be reinstated? That they would form a government and slavery would be ok again?
Cos now, lots of them are going to gaol for a while, and won’t be able to get jobs.
Cosplay General Hux with his assault rifle and Hitler Youth knife is now basically unemployable forever. What was his plan?
‘Hey, aren’t you that guy who said to a billion people that you’d shoot *all* boomers?’
Read 8 tweets
Dr Adam Rutherford Profile picture
19 Dec 20
Following the science my pert arse. They knew, we all knew that lockdown was needed in September, or October, or Last week. WHAT MYSTERIOUS BLACK MAGIC DID NEW ZEALAND HAVE THAT WE DON'T?
Lockdown skeptics. What a contemptible rash of cyphers, crushingly vapid grifters with not the brains nor the insight to even vaguely process the fartknocking poison that blarts from their stupid manmouths, like a weeping sore that would heal if they would only stop tonguing it.
Arrogant shitwits, who if they only knew that they know nothing, that would be something. But they don’t. And instead, bluster their way with fingers crossed against FUCKING EVOLUTION.
Read 5 tweets
Dr Adam Rutherford Profile picture
16 Dec 20
I see that there is a lot of chat about ancestry and indigeneity, two complex and profoundly misunderstood concepts. Here’s a thread 1/N - I have written about these ideas extensively, in two books; bit.ly/3r5iLDR
Ancestry rapidly becomes a matted web rather than a tree. Claims of ancestral purity are absurd. We are descended from multitudes, and don’t bear DNA from actual ancestors after very few generations. (fig. from @Graham_Coop
With both ancestry and indigeneity, the pertinent question is ‘when?’ If you claim ancestry from a certain group of people, then you are timestamping when you consider these ancestors to be important (to you). 3/N
Read 24 tweets
Dr Adam Rutherford Profile picture
13 Dec 20
Oh heavens. Briefly, the D in PhD, DPhil, EdD (et al) stands for Doctor, this qualification is a doctorate. It comes from the Latin docere - to teach. 1/n
It predates the use of doctor by medical practitioners, but society has agreed by consensus to refer to physicians as doctor, regardless of whether they have doctorates. This is fine and invoking an etymological origin doesn’t help. Dr Jill Biden is a doctor. 2/n
Oh yes it’s hilarious to say that someone who has a PhD in history can’t deliver a baby, but only if you’re a drooling gurgleturd. I myself have delivered 3 babies and also have a PhD, not in delivering babies but in developmental genetics. 3/n
Read 9 tweets
Dr Adam Rutherford Profile picture
30 Nov 20
The @DeepMind protein folding result is really incredible, and incredibly important. But I know it’s pretty tricky to understand, so here’s a megathread, with a bit of Biology 101, for @holland_tom @thehistoryguy
et al.

bit.ly/2JnKQoF
@DeepMind @holland_tom @thehistoryguy Here we go: Genes are long strings of molecules made up of an alphabet of four ‘letters’

e.g.

gacgaagagcccatgatcaacgac
@DeepMind @holland_tom @thehistoryguy Each triplet of letters encodes an amino acid (which we code as capital letters)

gac gaa gag ccc atg atc aac gac

translates to

D. E. E. P. M. I. N. D.
Read 16 tweets
Dr Adam Rutherford Profile picture
15 Nov 20
I'm seeing a lot of chat about PCR and COVID, some of it quite bonkers. So here’s a PCR 101.

DNA is very small and therefore not easy to detect. PCR is a tool for multiplying specific bits of DNA from a few to billions, thus making it easy to detect. 1/n
PCR is a standard tool in molecular biology, and has been for decades. It was, by the way, invented by Kary Mullis, who claims to have come up with the idea whilst tripping balls on LSD. Mullis was a bit of a jerk btw, an AIDS and Climate Change denialist. 2/n Kary Mullis, who was a bit of a jerk
Right, so DNA is a DOUBLE helix, meaning it has two strands made up of chains of just 4 ‘letters’ that pair up in a specific way (that is, ‘complementary’): A pairs with T, C pairs with G. a bit like this.

GAACTTAATTAA
CTTGAATTAATT

3/n
Read 17 tweets

Did Thread Reader help you today?

Support us! We are indie developers!

This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Too expensive? Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal Become our Patreon

Thank you for your support!

Follow Us on Twitter!

Like this author's thread?

Get emails when @AdamRutherford has new unrolls!

Check out other threads from @AdamRutherford!

Read all threads by @AdamRutherford