@deerbrian@richardhorton1 Before the trolls start... the above tweet is not even about Andrew Wakefield.
Wakefield was portrayed by the media as someone who committed fraud, but he did not. The charge was that he had not declared his legal work. Big deal...
Think about the fact that this paper was removed for "conflict of interest" when the only conflict was that the lead author was working with lawyers, which is normal practice. thelancet.com/journals/lance…
@deerbrian@richardhorton1 Yet Heather Lipkind and others are allowed to push investigational mRNA products - THAT WERE NEVER TESTED IN PREGNANCY - on pregnant women despite having documented Pfizer conflicts.
And he also fails to declare his involvement with the very "nudge units" (coercion factories) that propagandise these novel therapeutics that they know nothing about.
Why the double standards? Why is Wakefield destroyed for daring to publish a paper that highlighted a proven syndrome that destroyed the lives of 12 children.
Yet Lipkind, Ault and others like Paul Offit are allowed free reign?
Paul Offit's institute proudly declares $1bn in sponsored funding. His whole published dogma is vaccine mandates.
Yet none of it is relevant?
Really Paul?
As I said. Obscene.
These are the real anti-vaxxers. Those that drank from the trough and destroyed trust in medicine
• • •
Missing some Tweet in this thread? You can try to
force a refresh
@jsm2334 I have 3 new questions:
1⃣ why didn't you appear on the Razzaghi paper using your data?
2⃣ is your data synthetic?
3⃣ what is the binomial probability that 18/20 of a university's research team come from a group that comprises 2% of the US population, if all groups are equal?
@jsm2334 For those confused... The original thread on #OHDSI - the data curators claiming an impossible 96% efficacy rate for a type-mismatched vaccine against infection - is here.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1