π§π§π§
436 BILLION copies of spike protein circulating freely in plasma, a month after the Gene therapy vaccine.
In kids.
Their hearts will never fully recover.
You knew that, didn't you?
But there is more than that here...
THREAD [repost]
πππ
Note: This is a repost of an earlier thread that contained an important typo that I felt required a full thread rather than a correction at the end.
To avoid any claims of "misinformation" given how important this is, and how much the thread took off.
Let's resume
πππ
This is the damning graphic.
The vertical scale is a log scale.
The line at about 15pg/ml is the limit of detection, which is why the blue dots are there. There are still up to 100 billion molecules of spike in those patients - 20 days later.
But in some of these cases the concentration of spike is RISING 20 days after vaccination (see the red lines going up), so we have no idea how much is actually circulating.
Spike is toxic, particularly to the heart. If it's not toxic why do we need a "vaccine" against it?
The authors claim that the mean serum level of free spike protein in the patients with myocarditis was 34pg/ml.
(There was less in the non-affected patients, but there was still a lot)
How many molecules is that?
Well there is about 3000ml of plasma in a 70kg male...
And the mol weight of a spike protein monomer is 141kDa. That's 2.34 e-19 grams.
So 34pg/ml x 3000ml is a total of 102ng (102e-9) of spike.
Divide by 2.34e-19 gives you...
435,897,435,897 molecules.
Of a toxic protein.
Circulating in a young adult.
It's worth noting also that the blue dots in the graphic don't indicate "no spike" - they are the lower limits of detection at 15pg/ml. That's a lot of spike.
BUT...
There are two other things that have come out of this paper.
The first is that the amount of spike protein circulating in the PLASMA (when we were told it didn't leave the arm, remember) weeks after the injection is shocking.
But the worst thing about the Yonker #myocarditis study is this - and you might not have realised.
The study showed, beyond a shadow of doubt, that the COVID "vaccine" was causing myocarditis, with elevated troponin (confirming heart damage).
Well, that's a problem
It's a problem because the study authors should have raised an alarm after the first two or three cases.
You see, that was their duty. It was a duty as medical officers and as research officers.
But to our knowledge they said nothing and kept recruiting.
But it didn't matter that young people were getting myocarditis (with a known 5-year mortality of up to 50%). What mattered is finishing the study so they could publish.
Of course, from the home of the #surgisphere authors, what else would you expect?
Keep jabbing.
Thank you to the #mousearmy helpers who pointed out the previous wording error in the post.
Please feel free to add your own description of the number 435,897,435,897 in the comments!
β’ β’ β’
Missing some Tweet in this thread? You can try to
force a refresh
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. π
Sorry but this is not a believable study.
1β£ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2β£ No ethics approval despite clinical samples (blood and semen - seriously?)
3β£ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4β£Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.
It's like Georgia. Someone flood the polling station quick!
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.
The problem is that they now have 19 hours to keep the bots going.
@elonmusk please make poll voting a 2-step interaction. TY.