Immediate red flags are differences in the groups, such as the higher prevalence of smoking in the "COVID" group which hasn't been seen in real world studies. And the smoker group had the exact same educational history - you don't usually see that.
Always worth looking at the supplementary to look for inconsistencies in published data.
These figures on a test negative design show that the "effectiveness" was only 9%. Bearing in mind miscategorisation bias, this means there was negative efficacy against infection.
And, as we have seen previously, these non-randomised studies bias towards smokers in the unvaccinated group, which is the primary driver for preterm labour.
Oh look (RR=0.78, p<0.05)
Table 3b gives the outcomes for those pesky "unvaccinated" women by COVID status, showing the only fetal outcome difference was preterm birth, which could entirely be accounted for by the group smoking rates.
The UK maternal mortality rate is 7 per 100,000 births (2017).
In this series of unvaccinated women there were 4 deaths. This should not have happened. The probability of 4 deaths in 1732 patients... 0.00001
Note that the table 3b breakdown was not published for the vaccinated women, demonstrating an innate bias by the authors.
And one death has been removed in table 5, which should have 5 deaths in total if there was one death in the vaccinated group.
If there truly were 4 or 5 deaths in this series of 2738 pregnant women, the whole trial group should must be audited because this level of maternal mortality is off the scale.
Those 5 deaths... 4 were in the unvaccinated who received antibiotic treatment at a lower rate despite having "more COVID". Which likely means they had treatment withheld compared to the vaccinated group.
If that was the #3tablets needed for post-viral pneumonia...
It would suggest that those women were treated with prejudice, which resulted in their death.
So I am calling on EVERY death in that paper to be criminally and independently investigated.
@Yale could be up to their necks in the biggest HIPAA scandal since @UChicago
This is how the scam appears to have worked.
Harlan Krumholz owns a patent for managing health data through an app. "Hugo health" was the middle man providing the app to bait people claiming to be vaccine injured to join a study called LISTEN. But it was essentially being run on behalf of Pfizer/Janssen who paid him $3m in "research grants".
Thousands of injured signed up but only 241 patients were used in the "study" of which the publications were irrelevant and showed nothing other than "the vaccines saved millions of lives" bla bla. Nothing helpful for the vaccine injured at all.
But the bombshell - the data that they provided was able to be sold off to anyone they wanted to. It was in the consent form that most people didn't read. The data was held on hugo.health which has now gone. It was NOT HIPAA compliant.
How did we know that hugo.health's servers were not HIPAA compliant?
Yale told the participants in a email in July 2024 (attached).
So where did all that health data go?
Was it sold off to the highest bidder or used in a blackmail campaign against vulnerable people who were vaccine injured and couldn't work? (Like those that have targeted our accounts recently)
We don't know. But you can be damn sure that Yale knows, and took secret action to remedy the situation having already taken millions of dollars from pharma to run studies that undermined the vaccine injured.
That is why there is so much animosity suddenly being directed at the vaccine injured. They want to bury this story.
Yale could be in very big trouble.
They deserve a hashtag.
#YaleGate
@Yale @UChicago For those confused, please understand what a "limited hangout" is here. While you are rejoicing on the scraps of Daily Mail fodder, the pharma companies' new narrative is enshrined by those very articles.
@jsm2334 I have 3 new questions:
1⃣ why didn't you appear on the Razzaghi paper using your data?
2⃣ is your data synthetic?
3⃣ what is the binomial probability that 18/20 of a university's research team come from a group that comprises 2% of the US population, if all groups are equal?
@jsm2334 For those confused... The original thread on #OHDSI - the data curators claiming an impossible 96% efficacy rate for a type-mismatched vaccine against infection - is here.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.