Immediate red flags are differences in the groups, such as the higher prevalence of smoking in the "COVID" group which hasn't been seen in real world studies. And the smoker group had the exact same educational history - you don't usually see that.
Always worth looking at the supplementary to look for inconsistencies in published data.
These figures on a test negative design show that the "effectiveness" was only 9%. Bearing in mind miscategorisation bias, this means there was negative efficacy against infection.
And, as we have seen previously, these non-randomised studies bias towards smokers in the unvaccinated group, which is the primary driver for preterm labour.
Oh look (RR=0.78, p<0.05)
Table 3b gives the outcomes for those pesky "unvaccinated" women by COVID status, showing the only fetal outcome difference was preterm birth, which could entirely be accounted for by the group smoking rates.
The UK maternal mortality rate is 7 per 100,000 births (2017).
In this series of unvaccinated women there were 4 deaths. This should not have happened. The probability of 4 deaths in 1732 patients... 0.00001
Note that the table 3b breakdown was not published for the vaccinated women, demonstrating an innate bias by the authors.
And one death has been removed in table 5, which should have 5 deaths in total if there was one death in the vaccinated group.
If there truly were 4 or 5 deaths in this series of 2738 pregnant women, the whole trial group should must be audited because this level of maternal mortality is off the scale.
Those 5 deaths... 4 were in the unvaccinated who received antibiotic treatment at a lower rate despite having "more COVID". Which likely means they had treatment withheld compared to the vaccinated group.
If that was the #3tablets needed for post-viral pneumonia...
It would suggest that those women were treated with prejudice, which resulted in their death.
So I am calling on EVERY death in that paper to be criminally and independently investigated.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.
It's like Georgia. Someone flood the polling station quick!
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.
The problem is that they now have 19 hours to keep the bots going.
@elonmusk please make poll voting a 2-step interaction. TY.