In that study the fetal loss rate DOUBLED (4.2% to 9.8%) but had little impact on the overall number of fetuses.
This is how this information is hidden. That single slide should have been enough to prompt much more investigation, because it showed fewer fetuses in EVERY GROUP
But this is a DIFFERENT paper than the one Viki Male was (falsely) claiming to show a lack of effect on the fetus.
That paper was by Swingle at Uni Pennsylvania, here it is. Note one of the authors is Drew Weissman
Gotta say this looks like just a little bit of toxicity to me.
Now, think about this. If you lose the fetus prior to implantation due to drug toxicity, are you going to see that drug in the fetus?
Especially if you decide not to analyse the non-viable ones.
So you exclude the lost fetuses due to drug toxicity and then produce a plate in your study that shows that the fetuses that managed to avoid toxicity were the ones with the lowest drug transfer.
Giving you Viki's famous "the fetuses didn't glow" claim
And just for good measure, these two supposedly separate groups working on a separate paper have the same techniques and very similar looking plates.
What are the odds?
And remember when they told you "it stays in the arm" and denied it goes to the ovary?
You tell me whether they lied.
Look at the signal in the ovaries on A4 and B5.
Glowing. Hot.
And if you thought that was dramatic, wait till you see the uterus.
This is what a mouse uterus looks like. Like a lucky horsehoe.
Look at the signal in A4 and B5.
Lucky it doesn't get to the fetus eh?
So I'm not saying that the "non-glowing fetuses" are fake, but I'd like to see the original slides.
Especially now that we just found out that the peer review process in these papers appears to be a little "mates club" of pharma advocates.
So I'll finish here. It does seem that #PlacentaGate may be the tip of the iceberg in relation to the $cience around the safety of COVID vaccines in pregnancy.
NB: The LNPs referenced in these papers may be different from those in the mRNA COVID vaccines (we may never know), but they are all related compounds and designed for transfection of miRNA and mRNA.
@SECGov @Kevin_McKernan @SabinehazanMD Wow so this company is claiming influence with 11,000 scientists and multiple links lead back to pharma and the gene therapy corporations.
Broad institute. Who could have guessed?
#pubpeergate
@Yale could be up to their necks in the biggest HIPAA scandal since @UChicago
This is how the scam appears to have worked.
Harlan Krumholz owns a patent for managing health data through an app. "Hugo health" was the middle man providing the app to bait people claiming to be vaccine injured to join a study called LISTEN. But it was essentially being run on behalf of Pfizer/Janssen who paid him $3m in "research grants".
Thousands of injured signed up but only 241 patients were used in the "study" of which the publications were irrelevant and showed nothing other than "the vaccines saved millions of lives" bla bla. Nothing helpful for the vaccine injured at all.
But the bombshell - the data that they provided was able to be sold off to anyone they wanted to. It was in the consent form that most people didn't read. The data was held on hugo.health which has now gone. It was NOT HIPAA compliant.
How did we know that hugo.health's servers were not HIPAA compliant?
Yale told the participants in a email in July 2024 (attached).
So where did all that health data go?
Was it sold off to the highest bidder or used in a blackmail campaign against vulnerable people who were vaccine injured and couldn't work? (Like those that have targeted our accounts recently)
We don't know. But you can be damn sure that Yale knows, and took secret action to remedy the situation having already taken millions of dollars from pharma to run studies that undermined the vaccine injured.
That is why there is so much animosity suddenly being directed at the vaccine injured. They want to bury this story.
Yale could be in very big trouble.
They deserve a hashtag.
#YaleGate
@Yale @UChicago For those confused, please understand what a "limited hangout" is here. While you are rejoicing on the scraps of Daily Mail fodder, the pharma companies' new narrative is enshrined by those very articles.
@jsm2334 I have 3 new questions:
1⃣ why didn't you appear on the Razzaghi paper using your data?
2⃣ is your data synthetic?
3⃣ what is the binomial probability that 18/20 of a university's research team come from a group that comprises 2% of the US population, if all groups are equal?
@jsm2334 For those confused... The original thread on #OHDSI - the data curators claiming an impossible 96% efficacy rate for a type-mismatched vaccine against infection - is here.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...