Share this page!

Enter URL or ID to Unroll

You can paste full URL like: https://x.com/threadreaderapp/status/1644127596119195649
or just the ID like: 1644127596119195649

How to get URL link on X (Twitter) App

  1. On the Twitter thread, click on or icon on the bottom
  2. Click again on or Share Via icon
  3. Click on Copy Link to Tweet
  4. Paste it above and click "Unroll Thread"!
  5. More info at Twitter Help
Jikkyleaks 🐭 Profile picture
@Jikkyleaks
Mar 19, 2023 • 18 tweets • 8 min read • Read on X
Scrolly
More #Placentagate 🧀🧀🧀

This could be one of the biggest scandals in medicine.

Check this out.
What do you see?
biorxiv.org/content/10.110… Image
Can you see that there are fewer fetuses in all the treatment groups compared to saline?

It's not dramatic, because the authors published that figure instead of the number of fetal losses.

Look what the Pfizer BNT162b2 animal study showed:
arkmedic.substack.com/p/the-miscarri… Image
In that study the fetal loss rate DOUBLED (4.2% to 9.8%) but had little impact on the overall number of fetuses.

This is how this information is hidden. That single slide should have been enough to prompt much more investigation, because it showed fewer fetuses in EVERY GROUP Image
But this is a DIFFERENT paper than the one Viki Male was (falsely) claiming to show a lack of effect on the fetus.

That paper was by Swingle at Uni Pennsylvania, here it is. Note one of the authors is Drew Weissman

pubmed.ncbi.nlm.nih.gov/36789893/
The one with the fetal losses slide is a preprint by Rachel Young at the Dept of biomedical engineering (🤔) at Glassboro, NJ.

Yet also features Drew Weissman.

No toxicity huh?

biorxiv.org/content/10.110… Image
Gotta say this looks like just a little bit of toxicity to me. Image
Now, think about this. If you lose the fetus prior to implantation due to drug toxicity, are you going to see that drug in the fetus?

Especially if you decide not to analyse the non-viable ones. Image
So you exclude the lost fetuses due to drug toxicity and then produce a plate in your study that shows that the fetuses that managed to avoid toxicity were the ones with the lowest drug transfer.

Giving you Viki's famous "the fetuses didn't glow" claim Top: LNP-mRNA shown in the ...
And just for good measure, these two supposedly separate groups working on a separate paper have the same techniques and very similar looking plates.

What are the odds? https://www.ncbi.nlm.nih.go...https://www.biorxiv.org/con...
And remember when they told you "it stays in the arm" and denied it goes to the ovary?

You tell me whether they lied.
Look at the signal in the ovaries on A4 and B5.

Glowing. Hot. https://www.ncbi.nlm.nih.go...
And if you thought that was dramatic, wait till you see the uterus.

This is what a mouse uterus looks like. Like a lucky horsehoe.

Look at the signal in A4 and B5.

Lucky it doesn't get to the fetus eh? Image
So I'm not saying that the "non-glowing fetuses" are fake, but I'd like to see the original slides.

Especially now that we just found out that the peer review process in these papers appears to be a little "mates club" of pharma advocates.
And the inclusion of Drew Weissman (and Mohamad Alameh) in both those supposedly unrelated papers... Just a coincidence

bu.edu/articles/2021/…
So I'll finish here. It does seem that #PlacentaGate may be the tip of the iceberg in relation to the $cience around the safety of COVID vaccines in pregnancy.

There will be more, of that I'm sure.

@chrismartenson @MarchandSurgery @RWMaloneMD @MaryanneDemasi @sonia_elijah
NB: The LNPs referenced in these papers may be different from those in the mRNA COVID vaccines (we may never know), but they are all related compounds and designed for transfection of miRNA and mRNA.

There is no reason to believe that the COVID LNP are biorxiv.org/content/10.110…… twitter.com/i/web/status/1…
Added:
Added:
Added for reference:

• • •

Missing some Tweet in this thread? You can try to force a refresh
　

Keep Current with Jikkyleaks 🐭

Jikkyleaks 🐭 Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @Jikkyleaks

Jikkyleaks 🐭 Profile picture
Dec 12
@jsm2334 I have 3 new questions:
1⃣ why didn't you appear on the Razzaghi paper using your data?
2⃣ is your data synthetic?
3⃣ what is the binomial probability that 18/20 of a university's research team come from a group that comprises 2% of the US population, if all groups are equal? Image
Image
@jsm2334 For those confused... The original thread on #OHDSI - the data curators claiming an impossible 96% efficacy rate for a type-mismatched vaccine against infection - is here.

This is not their first rodeo in synthetic data

#EMRgate #Surgisphere

@jsm2334 And there we are.
Kevin Haynes confirming that @OHDSI is run by Johnson & Johnson (AKA Janssen).
youtube.com/watch?v=lEYmH0…
x.com/Jikkyleaks/sta…
Read 4 tweets
Jikkyleaks 🐭 Profile picture
Nov 10
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 No. They have not monitored them. We have an FOI on this
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 TGA FOI 5274. Refused.
(part 1 of 2).

The TGA has no idea how many miscarriages occurred after COVID vaccination because they had no interest.

Their only interest is in protecting their income stream and the Bollinger.

@SenatorRennick @DrJulieSladden @BroadbentMP Image
Image
Image
Image
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 @SenatorRennick @DrJulieSladden @BroadbentMP TGA FOI 5274. Refused.
(part 2 of 2).

No pharmacovigilance was performed.
The TGA lied.

#placentagate Image
Image
Image
Read 5 tweets
Jikkyleaks 🐭 Profile picture
Nov 7
Are you looking for this @VaccineMole ?

Declared "BGH polyA" sequence (226bp): CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTG
CCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTAT
TCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGAT
GCGGTGGGCTCTATGG

Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC

So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...

jbc.org/article/S0021-…

I'll try and find the missing sequence
#SV40Gate #PlasmidGateImage
Image
@Kevin_McKernan @VaccineMole Add in a CMV promoter for good measure and perhaps a soupcon of cancer to boot.

THIS IS WHY YOU DO NOT PUT PLASMIDS INTO LIPID NANOPARTICLES AND TRANSFECT THEM INTO HUMANS.
pmc.ncbi.nlm.nih.gov/articles/PMC26…

x.com/Jikkyleaks/sta…
Here it is.
The Oxford plasmid.
"SpyTag" and "SnoopTag" and a CMV promoter with the moo cow equivalent of SV40 in the PolyA.

I'm sure it's just a coincidence.

#TagGate
@FeeRedfern @JesslovesMJK @double_christ
ncbi.nlm.nih.gov/nucleotide/KU3…
ncbi.nlm.nih.gov/nucleotide/KY9…
pubmed.ncbi.nlm.nih.gov/26781591/Image
Image
Read 7 tweets
Jikkyleaks 🐭 Profile picture
Aug 10
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
@DiedSuddenly_ Addendum: Some undeclared replication of images from the Jeon paper in 2022, same journal.
Jeon (left):
Lee (right):


@JesslovesMJK @Kevin_McKernan
#NanoGate ijvtpr.com/index.php/IJVT…
mail.ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄

#NanoGate Image
Read 4 tweets
Jikkyleaks 🐭 Profile picture
Aug 10
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag

My view reading this is:

This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.

I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.Image
Image
Image
Image
@DiedSuddenly_ A bowling alley?

I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.

This was from 2022:


I wonder if they targeted Broudy to add some credence to the LARP. ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
Read 4 tweets
Jikkyleaks 🐭 Profile picture
Jun 16
@SenatorRennick The #3tablets protocols and #midazolam murders were the primary drivers of "COVID" death prior to the GMO rollout.

The publishers, who remain nameless, should be called to give evidence.covid19evidence.net.au
What in the holy hell?

The website which was used to propagandise the treatment of COVID during 2020-2024, and withhold effective treatments from people who then died..

Is now an air freight site.

THIS IS WHY WE ARCHIVE.

@tonynikolic10 @BroadbentMPcovid19evidence.net.auImage
https://archive.is/dEBZ1
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.

It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law
archive.is/dEBZ1
Read 4 tweets

Did Thread Reader help you today?

Support us! We are indie developers!

This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Don't want to be a Premium member but still want to support us?

Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal

Or Donate anonymously using crypto!

Ethereum

0xfe58350B80634f60Fa6Dc149a72b4DFbc17D341E copy

Bitcoin

3ATGMxNzCUFzxpMCHL5sWSt4DVtS8UqXpi copy

Thank you for your support!

Follow Us!

Send Email!

:(