Jikkyleaks 🐭 Profile picture
Jun 20, 2023 14 tweets 8 min read Read on X
HOT(ez) Cheese 🧀🧀🧀!

The $1m+ grant awarded to @PeterHotez was co-awarded to Maria Bottazzi and Shibo Jiang

Shibo Jiang's affiliation was with the New York Blood Centre and Fudan University Shanghai.

His publications were on peptide inhibitors for viruses.
#HotezGate 🧵 twitter.com/i/web/status/1… Shibo Jiang's extensive col...
Here is the record of the grant award for AI098775
reporter.nih.gov/search/JpI7Q6y… Image
And here is Shibo Jiang developing peptide inhibitors for Gp-120.... one of the homologous regions of the COVID spike protein that was inserted by "unknown" entities...

But wait. Peptide inhibitors?

@CharlesRixey
pubmed.ncbi.nlm.nih.gov/31374953/ Image
Oh look who he pops up with. His buddy Zengli Shi, the "Batwoman" whose lab were the source of the Wuhan COVID outbreak.

"Development of Viral Fusion inhibitors" you say? ImageImage
Well Zengli Shi had already developed those fusion inhibitors years before. So why weren't they available to the public, if this coronavirus was so deadly?

ncbi.nlm.nih.gov/labs/pmc/artic… Image
Of course Shibo Jiang knew this because he wrote that paper with Zengli Shi.

Assuming he actually wrote it, given that he was literally writing hundreds of papers. Image
Not only were the NIH funding Hotez, but also funding Zhi and Jiang who developed "an effective inhibitor for coronaviruses"...

Which was kept from the world.

Just like the #3tablets antibiotics that would have prevented COVID pneumonia deaths

So now we have a NIH grant awarded to Hotez (who was supposedly working on Coronavirus vaccines for years) and at the same time to the people intimately involved in making a "pandemic" coronavirus for which they had an inhibitor.

And Maria Bottazzi...
archive.is/SS10t ImageImage
And this "dream team" was supposed to be "curing forgotten tropical diseases".

Including ones that coincidentally caused cardiomyopathy (sequelae of myocarditis), for which they were trying to patent a new treatment.

How coincidental. ImageImage
Here's the full list of papers between Bottazzi and Hotez - 176 in total and 100 in the last 5 years.

It's amazing how they could write all those in the time, without help from #BigPharma ghost writers - given how busy they were trying to save the world

pubmed.ncbi.nlm.nih.gov/?term=bottazzi…
So in summary here we have the smoking gun evidence that the NIH were funding the very people who were not only responsible for developing new pandemic coronaviruses that would shut down the world....

But despite years of funding never released a single beneficial product.
And stand to make millions by channelling more government money to their coffers, and millions more from their patents for the very cardiomyopathies their products have caused.

Let's play jeopardy.
The answer is "money laundering".
What's the question? Image
Remember that this is just the tip of the iceberg of the links between people who have vested interests in controlling the population with pandemic fear and at the same time creating and enforcing vaccines (however bad they are) on us.

#Modernagate #CTCCTCGGCGGGCACGTAG
ADDENDUM: How it works...

Collude to create a "pandemic" that kills 6m+ people, whilst keeping your inhibitor to yourself.

Get promotion to the journal that quashed a perfectly good paper showing the cancer risk of the COVID mRNA.

Welcome to Gilead.
arkmedic.substack.com/p/welcome-to-g…twitter.com/i/web/status/1… https://www.mdpi.com/about/...

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Jikkyleaks 🐭

Jikkyleaks 🐭 Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @Jikkyleaks

Nov 10
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 No. They have not monitored them. We have an FOI on this
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 TGA FOI 5274. Refused.
(part 1 of 2).

The TGA has no idea how many miscarriages occurred after COVID vaccination because they had no interest.

Their only interest is in protecting their income stream and the Bollinger.

@SenatorRennick @DrJulieSladden @BroadbentMP Image
Image
Image
Image
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 @SenatorRennick @DrJulieSladden @BroadbentMP TGA FOI 5274. Refused.
(part 2 of 2).

No pharmacovigilance was performed.
The TGA lied.

#placentagate Image
Image
Image
Read 5 tweets
Nov 7
Are you looking for this @VaccineMole ?

Declared "BGH polyA" sequence (226bp): CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTG
CCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTAT
TCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGAT
GCGGTGGGCTCTATGG

Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC

So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...

jbc.org/article/S0021-…

I'll try and find the missing sequence
#SV40Gate #PlasmidGateImage
Image
@Kevin_McKernan @VaccineMole Add in a CMV promoter for good measure and perhaps a soupcon of cancer to boot.

THIS IS WHY YOU DO NOT PUT PLASMIDS INTO LIPID NANOPARTICLES AND TRANSFECT THEM INTO HUMANS.
pmc.ncbi.nlm.nih.gov/articles/PMC26…

x.com/Jikkyleaks/sta…
Here it is.
The Oxford plasmid.
"SpyTag" and "SnoopTag" and a CMV promoter with the moo cow equivalent of SV40 in the PolyA.

I'm sure it's just a coincidence.

#TagGate
@FeeRedfern @JesslovesMJK @double_christ
ncbi.nlm.nih.gov/nucleotide/KU3…
ncbi.nlm.nih.gov/nucleotide/KY9…
pubmed.ncbi.nlm.nih.gov/26781591/Image
Image
Read 7 tweets
Aug 10
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
@DiedSuddenly_ Addendum: Some undeclared replication of images from the Jeon paper in 2022, same journal.
Jeon (left):
Lee (right):


@JesslovesMJK @Kevin_McKernan
#NanoGate ijvtpr.com/index.php/IJVT…
mail.ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄

#NanoGate Image
Read 4 tweets
Aug 10
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag

My view reading this is:

This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.

I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.Image
Image
Image
Image
@DiedSuddenly_ A bowling alley?

I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.

This was from 2022:


I wonder if they targeted Broudy to add some credence to the LARP. ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
Read 4 tweets
Jun 16
@SenatorRennick The #3tablets protocols and #midazolam murders were the primary drivers of "COVID" death prior to the GMO rollout.

The publishers, who remain nameless, should be called to give evidence.covid19evidence.net.au
What in the holy hell?

The website which was used to propagandise the treatment of COVID during 2020-2024, and withhold effective treatments from people who then died..

Is now an air freight site.

THIS IS WHY WE ARCHIVE.

@tonynikolic10 @BroadbentMPcovid19evidence.net.auImage
https://archive.is/dEBZ1
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.

It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law
archive.is/dEBZ1
Read 4 tweets
Jan 25
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.

It's like Georgia. Someone flood the polling station quick! Image
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.

The problem is that they now have 19 hours to keep the bots going.

@elonmusk please make poll voting a 2-step interaction. TY.
Image
Image
Read 9 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Don't want to be a Premium member but still want to support us?

Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal

Or Donate anonymously using crypto!

Ethereum

0xfe58350B80634f60Fa6Dc149a72b4DFbc17D341E copy

Bitcoin

3ATGMxNzCUFzxpMCHL5sWSt4DVtS8UqXpi copy

Thank you for your support!

Follow Us!

:(