And here is Shibo Jiang developing peptide inhibitors for Gp-120.... one of the homologous regions of the COVID spike protein that was inserted by "unknown" entities...
Oh look who he pops up with. His buddy Zengli Shi, the "Batwoman" whose lab were the source of the Wuhan COVID outbreak.
"Development of Viral Fusion inhibitors" you say?
Well Zengli Shi had already developed those fusion inhibitors years before. So why weren't they available to the public, if this coronavirus was so deadly?
So now we have a NIH grant awarded to Hotez (who was supposedly working on Coronavirus vaccines for years) and at the same time to the people intimately involved in making a "pandemic" coronavirus for which they had an inhibitor.
And this "dream team" was supposed to be "curing forgotten tropical diseases".
Including ones that coincidentally caused cardiomyopathy (sequelae of myocarditis), for which they were trying to patent a new treatment.
How coincidental.
Here's the full list of papers between Bottazzi and Hotez - 176 in total and 100 in the last 5 years.
It's amazing how they could write all those in the time, without help from #BigPharma ghost writers - given how busy they were trying to save the world
So in summary here we have the smoking gun evidence that the NIH were funding the very people who were not only responsible for developing new pandemic coronaviruses that would shut down the world....
But despite years of funding never released a single beneficial product.
And stand to make millions by channelling more government money to their coffers, and millions more from their patents for the very cardiomyopathies their products have caused.
Let's play jeopardy.
The answer is "money laundering".
What's the question?
Remember that this is just the tip of the iceberg of the links between people who have vested interests in controlling the population with pandemic fear and at the same time creating and enforcing vaccines (however bad they are) on us.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.
It's like Georgia. Someone flood the polling station quick!
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.
The problem is that they now have 19 hours to keep the bots going.
@elonmusk please make poll voting a 2-step interaction. TY.