Jikkyleaks 🐭 Profile picture
Jan 14, 2023 24 tweets 13 min read Read on X
WHOA... this looks like #surgisphere the sequel

The claim that statins improve the outcome of #COVID was proven fake when the original authors made it.

Now you miraculously found another database?

No way.
@Inspiteofmysel1 @chrismartenson
This is the ASA abstract.

If this data is published without the data set for analysis it should be immediately stamped with an expression of concern

asahq.org/about-asa/news…
There are red flags all over this. This is EXACTLY what #surgisphere claimed.

"The Institutional review boards said this was exempt"

It doesn't work like that.
Where is the IRB reference?

You can't just give up 90,000 patients' personal data without ethics approval.
This is from the same database published by the same author.

No indication of where the data was from.

ncbi.nlm.nih.gov/pmc/articles/P…
All these people put their affiliations as the Dept of Surgery but Ettore Crimi is supposed to be affiliated with the department of anesthesiology

And a handful of surgeons trawling through a 93,000 patient database?

Possible, but unlikely without help.
For comparison, remember this infamous 44,000 patient study that had the billion-dollar resources of every Pfizer scientist thrown at it, and a long list of authors (who didn't actually write the paper).
The documents required to sift through double that number of patients is phenomenal.

Remember that the FDA needed 75 years to check their documents from the 44,000 Pfizer trial?

But they crunched the data with a handful of helpers?

euroweeklynews.com/2021/12/09/fda…
Lead author Ettore Crimi is affiliated with @EnvisionLeads a large healthcare provider in the US..

Did they release their patient's data without IRB approval?

They sure like propaganda
And, just like #surgisphere's Sapan Desai - whose fraudulent papers were ghost written - Crimi had a quite sparse publication history prior to 2020.

Small studies and case reports. Typical for a clinician.
pubmed.ncbi.nlm.nih.gov/?term=%28%28cr…
Yet we're expected to believe that someone handed Crimi a 93,000 patient database without IRB approval for analysis and they miraculously found that statins reduce COVID death rates, 3 years after the data was collected?

Not buying it. Sorry
And who reported this?

Emily Henderson of "News Medical Life Sciences" @newsmedical, a pharma marketing journal part of the AZO marketing network.

So you can take the claim with a pinch of salt.
Maybe I'm wrong here - but I will make this prediction:

Ettore Crimi will never release that dataset for analysis.

You know why?

Half of their ventilated patients died.
HALF.
And that database - if it's real - will show what treatment those patients did or didn't receive that set them on a pathway to a 50% mortality

@richardursomd @P_McCulloughMD @LynnFynn3
And I will hazard a bet that the patients in this study did not get the #3tablets of antibiotics that would have prevented them going to a ventilator with a 50% mortality.

Just before Crimi's recruitment to the "COVID publication lottery prizes" he published a paper on antibiotic resistance - the same dogma we saw in the #3tablets scandal.

ncbi.nlm.nih.gov/pmc/articles/P…
So as an AMR (antimicrobial resistance) steward it's a good bet that their patients didn't get antibiotics to prevent secondary pneumonia in COVID. Hence the 50% mortality. Good for recruitment to a study though, I guess.
Yet there is something fishy about that clinical epigenetics paper - because Crimi has NO published prior background in epigenetics. It's not something you just write about. It's one of the most complex fields of molecular biology.

He's an anaesthetist.
@JesslovesMJK
@JesslovesMJK His first epigenetics paper was in 2019 with the same group of people - from Italy, not the US.
@JesslovesMJK And coincidentally the work was funded out of Italy with this grant number that just happens to be associated with Dr Concetta Schiano
@JesslovesMJK Who also happens to have published on epigenetics in a completely different journal at the same time without Crimi.

And happens to have a PhD and a history of publications in epigenetics
pubmed.ncbi.nlm.nih.gov/?term=schiano%…
And coincidentally Schiano - the PhD epigeneticist - has a very similar writing style to Crimi - the anaesthetist.

These two passages are from different papers. The first, Schiano's (pubmed.ncbi.nlm.nih.gov/32790754/) and the second Crimi's (ncbi.nlm.nih.gov/pmc/articles/P…)
So the explanations for this might be that Crimi is Schiano's PhD student and he is doing a 3-year+ sabbatical in the lab.

Or that Schiano ghost wrote the epigenetics papers.

If it's the latter then Ettore Crimi has some explaining to do
Because otherwise it's just another #surgisphere scandal used to push pharma drugs under the umbrella of "COVID".

And given that I was right about the first one, I would put a few dollars on the answer to this one.

/end
the-scientist.com/features/the-s…

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Jikkyleaks 🐭

Jikkyleaks 🐭 Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @Jikkyleaks

Dec 12, 2024
@jsm2334 I have 3 new questions:
1⃣ why didn't you appear on the Razzaghi paper using your data?
2⃣ is your data synthetic?
3⃣ what is the binomial probability that 18/20 of a university's research team come from a group that comprises 2% of the US population, if all groups are equal? Image
Image
@jsm2334 For those confused... The original thread on #OHDSI - the data curators claiming an impossible 96% efficacy rate for a type-mismatched vaccine against infection - is here.

This is not their first rodeo in synthetic data

#EMRgate #Surgisphere

@jsm2334 And there we are.
Kevin Haynes confirming that @OHDSI is run by Johnson & Johnson (AKA Janssen).
youtube.com/watch?v=lEYmH0…
x.com/Jikkyleaks/sta…
Read 4 tweets
Nov 10, 2024
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 No. They have not monitored them. We have an FOI on this
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 TGA FOI 5274. Refused.
(part 1 of 2).

The TGA has no idea how many miscarriages occurred after COVID vaccination because they had no interest.

Their only interest is in protecting their income stream and the Bollinger.

@SenatorRennick @DrJulieSladden @BroadbentMP Image
Image
Image
Image
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 @SenatorRennick @DrJulieSladden @BroadbentMP TGA FOI 5274. Refused.
(part 2 of 2).

No pharmacovigilance was performed.
The TGA lied.

#placentagate Image
Image
Image
Read 5 tweets
Nov 7, 2024
Are you looking for this @VaccineMole ?

Declared "BGH polyA" sequence (226bp): CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTG
CCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTAT
TCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGAT
GCGGTGGGCTCTATGG

Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC

So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...

jbc.org/article/S0021-…

I'll try and find the missing sequence
#SV40Gate #PlasmidGateImage
Image
@Kevin_McKernan @VaccineMole Add in a CMV promoter for good measure and perhaps a soupcon of cancer to boot.

THIS IS WHY YOU DO NOT PUT PLASMIDS INTO LIPID NANOPARTICLES AND TRANSFECT THEM INTO HUMANS.
pmc.ncbi.nlm.nih.gov/articles/PMC26…

x.com/Jikkyleaks/sta…
Here it is.
The Oxford plasmid.
"SpyTag" and "SnoopTag" and a CMV promoter with the moo cow equivalent of SV40 in the PolyA.

I'm sure it's just a coincidence.

#TagGate
@FeeRedfern @JesslovesMJK @double_christ
ncbi.nlm.nih.gov/nucleotide/KU3…
ncbi.nlm.nih.gov/nucleotide/KY9…
pubmed.ncbi.nlm.nih.gov/26781591/Image
Image
Read 7 tweets
Aug 10, 2024
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
@DiedSuddenly_ Addendum: Some undeclared replication of images from the Jeon paper in 2022, same journal.
Jeon (left):
Lee (right):


@JesslovesMJK @Kevin_McKernan
#NanoGate ijvtpr.com/index.php/IJVT…
mail.ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄

#NanoGate Image
Read 4 tweets
Aug 10, 2024
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag

My view reading this is:

This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.

I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.Image
Image
Image
Image
@DiedSuddenly_ A bowling alley?

I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.

This was from 2022:


I wonder if they targeted Broudy to add some credence to the LARP. ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
Read 4 tweets
Jun 16, 2024
@SenatorRennick The #3tablets protocols and #midazolam murders were the primary drivers of "COVID" death prior to the GMO rollout.

The publishers, who remain nameless, should be called to give evidence.covid19evidence.net.au
What in the holy hell?

The website which was used to propagandise the treatment of COVID during 2020-2024, and withhold effective treatments from people who then died..

Is now an air freight site.

THIS IS WHY WE ARCHIVE.

@tonynikolic10 @BroadbentMPcovid19evidence.net.auImage
https://archive.is/dEBZ1
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.

It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law
archive.is/dEBZ1
Read 4 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Don't want to be a Premium member but still want to support us?

Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal

Or Donate anonymously using crypto!

Ethereum

0xfe58350B80634f60Fa6Dc149a72b4DFbc17D341E copy

Bitcoin

3ATGMxNzCUFzxpMCHL5sWSt4DVtS8UqXpi copy

Thank you for your support!

Follow Us!

:(