Jikkyleaks 🐭 Profile picture
Feb 1, 2023 15 tweets 12 min read Read on X
I agree .@lonnibesancon - this is shameless.

You, Bik, Gideon and Sheldrick did nothing to expose #surgisphere.

We did. The people you hate so much and denigrate. Doctors and scientists who are not supported by pharma millions.
@chrismartenson Image
And yet you join the ranks of the "no-expertise experts" recruited in 2020 do fulfil a particular role in #COVID

Just one first author paper before 2020.

How does someone get a PhD with one first author paper? Image
And then suddenly you are given the job of writing papers with @GidMK which go straight into @NEJM, the home of the #surgisphere fraud.

Who fast-tracked your paper?

Who are you - with no research history - to be first author on this letter to NEJM?

pubmed.ncbi.nlm.nih.gov/?term=Besan%C3… Image
Now... where have I seen this before @FeeRedfern?

Vanatech "behavioural sciences" in the UK?

A shell company. Nudge units.

Where did I catch them before?
How did Steadson call you to write this letter?
Who is David Steadson? ImageImage
@DavidSteadson only has two papers on pubmed.gov in total.

So why is he running an extremely suspicious and coviert "behavioural engineering" unit and getting Besancon to front letters to the @NEJM?

What exactly do @vana_tech do? Image
David Steadson (with the Azov flag in his bio) has ZERO medical publications pre-COVID.

So if he is not driving Lonni, that means it must be @FLAHAULT (the 3rd author) at the "Institute of Global Health"

Hmmm ImageImage
Flahault is a huge name in "Global Health" aka WHO aka "OneHealth" - all linked organisations.

Hugely eminent, but now on the dark side of medicine.

So how does he get involved with two hardly-published authors to front a letter to the @NEJM? Image
Well through @vana_tech of course - the company that does "nothing" and has no presence on the internet.

▶️Find a junior researcher with no publications.
▶️Ghost write a script for them.
▶️Use your bigwig to underwrite the letter.
and finally...
▶️Publish in the totally captured @TheLancet or @NEJM both of which publish total junk like #surgisphere...

Which they would have gotten away with if it hadn't been for those pesky #mousearmy twitterers
And THAT is how your unknown researcher gets elevated to "expert"

And THAT is #poogate and #lancetgate and #BeijingGideon and #ChisquaredKyle and all the other astroturf "fraud busters".

And I bet if you look hard enough you will find a link between Vanatech and recently exposed 77th brigade...

Or Andrew Hill, @UNITAID and the #MAGICapp that led to so many deaths by withdrawing antibiotics from the elderly.

This is not over. Not by a long chalk
#3tblets.
Well I think we have the answer.

Steadson's following list is a real who's who of COVID zealots, including Daszak, Gorski, Bik, multiple 77th accounts.

And... Ukraine extremists
And... ASIO.
I mean, who TF follows ASIO?

This guy makes Alexander Downer look tame. ImageImageImage
I'll be blocking #UkraineDave as I do with all the Azov accounts.

It's not worth the hassle of engaging with the military "disinformation units".

They will expose themselves eventually.

He can bleat all he wants.
archive.is/wip/QRVbu
Yes the 77th brigade are real.

Real scum committing real treason.

Not real soldiers.

This one's for you @FeeRedfern

Vanatech and BETA - the Australian government AI nudge unit.

Did AI create the MAGIC app protocol that killed so many of our elderly because AI does not understand the nuances of human medicine? Image

• • •

Missing some Tweet in this thread? You can try to force a refresh
 

Keep Current with Jikkyleaks 🐭

Jikkyleaks 🐭 Profile picture

Stay in touch and get notified when new unrolls are available from this author!

Read all threads

This Thread may be Removed Anytime!

PDF

Twitter may remove this content at anytime! Save it as PDF for later use!

Try unrolling a thread yourself!

how to unroll video
  1. Follow @ThreadReaderApp to mention us!

  2. From a Twitter thread mention us with a keyword "unroll"
@threadreaderapp unroll

Practice here first or read more on our help page!

More from @Jikkyleaks

Nov 10
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 No. They have not monitored them. We have an FOI on this
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 TGA FOI 5274. Refused.
(part 1 of 2).

The TGA has no idea how many miscarriages occurred after COVID vaccination because they had no interest.

Their only interest is in protecting their income stream and the Bollinger.

@SenatorRennick @DrJulieSladden @BroadbentMP Image
Image
Image
Image
@LostInTheNet1 @Truelovefaith1 @man_rocket97805 @SenatorRennick @DrJulieSladden @BroadbentMP TGA FOI 5274. Refused.
(part 2 of 2).

No pharmacovigilance was performed.
The TGA lied.

#placentagate Image
Image
Image
Read 5 tweets
Nov 7
Are you looking for this @VaccineMole ?

Declared "BGH polyA" sequence (226bp): CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTG
CCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTAT
TCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGAT
GCGGTGGGCTCTATGG

Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC

So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...

jbc.org/article/S0021-…

I'll try and find the missing sequence
#SV40Gate #PlasmidGateImage
Image
@Kevin_McKernan @VaccineMole Add in a CMV promoter for good measure and perhaps a soupcon of cancer to boot.

THIS IS WHY YOU DO NOT PUT PLASMIDS INTO LIPID NANOPARTICLES AND TRANSFECT THEM INTO HUMANS.
pmc.ncbi.nlm.nih.gov/articles/PMC26…

x.com/Jikkyleaks/sta…
Here it is.
The Oxford plasmid.
"SpyTag" and "SnoopTag" and a CMV promoter with the moo cow equivalent of SV40 in the PolyA.

I'm sure it's just a coincidence.

#TagGate
@FeeRedfern @JesslovesMJK @double_christ
ncbi.nlm.nih.gov/nucleotide/KU3…
ncbi.nlm.nih.gov/nucleotide/KY9…
pubmed.ncbi.nlm.nih.gov/26781591/Image
Image
Read 7 tweets
Aug 10
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
@DiedSuddenly_ Addendum: Some undeclared replication of images from the Jeon paper in 2022, same journal.
Jeon (left):
Lee (right):


@JesslovesMJK @Kevin_McKernan
#NanoGate ijvtpr.com/index.php/IJVT…
mail.ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄

#NanoGate Image
Read 4 tweets
Aug 10
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag

My view reading this is:

This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.

I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.Image
Image
Image
Image
@DiedSuddenly_ A bowling alley?

I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.

This was from 2022:


I wonder if they targeted Broudy to add some credence to the LARP. ijvtpr.com/index.php/IJVT…

Image
Image
@DiedSuddenly_ I can find no evidence that these people exist in the scientific or clinical research realm
ijvtpr.com/index.php/IJVT…
Read 4 tweets
Jun 16
@SenatorRennick The #3tablets protocols and #midazolam murders were the primary drivers of "COVID" death prior to the GMO rollout.

The publishers, who remain nameless, should be called to give evidence.covid19evidence.net.au
What in the holy hell?

The website which was used to propagandise the treatment of COVID during 2020-2024, and withhold effective treatments from people who then died..

Is now an air freight site.

THIS IS WHY WE ARCHIVE.

@tonynikolic10 @BroadbentMPcovid19evidence.net.auImage
https://archive.is/dEBZ1
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.

It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law
archive.is/dEBZ1
Read 4 tweets
Jan 25
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.

It's like Georgia. Someone flood the polling station quick! Image
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.

The problem is that they now have 19 hours to keep the bots going.

@elonmusk please make poll voting a 2-step interaction. TY.
Image
Image
Read 9 tweets

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just two indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3/month or $30/year) and get exclusive features!

Become Premium

Don't want to be a Premium member but still want to support us?

Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal

Or Donate anonymously using crypto!

Ethereum

0xfe58350B80634f60Fa6Dc149a72b4DFbc17D341E copy

Bitcoin

3ATGMxNzCUFzxpMCHL5sWSt4DVtS8UqXpi copy

Thank you for your support!

Follow Us!

:(