So it seems likely that the only reason that 4991 exists (well the RdRp only) is to form a cover for a manufactured coronavirus. There is no other explanation. No more of the genome of this exists.
What drew my attention to this?
Well 4991 was used by certain members of #DRASTIC to publish a paper that promoted the assumption that #RaTG13 was real. It isn't.
#RaTG13 was touted as the precursor of #SARSCoV2 but it is fake. It didn't appear in Genbank until after SC2. It doesn't appear in ANY research papers before SC2.
Anybody promoting RaTG13 as real is acting to protect the makers of the #covid19 virus.
Which suggests to me that the authors - who seem very close - are promoting a narrative of deflection.
Of course, I might be wrong.
There are many write-ups on the fakery of RaTG13 - including from our very own favourite @Daoyu15 but this one is relatively easy to read.
And just to clarify, I am not claiming that 4991 is fake. Quite to the contrary. I am claiming it was one of many attempts to make viral subgenomes by the WIV in preparation for the "big one".
So I'll leave it there. @jjcouey@CharlesRixey feel free to disagree, this is science
• • •
Missing some Tweet in this thread? You can try to
force a refresh
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.
It's like Georgia. Someone flood the polling station quick!
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.
The problem is that they now have 19 hours to keep the bots going.
@elonmusk please make poll voting a 2-step interaction. TY.