Thread by @DrEricDing

PANDEMIC CRIME AGAINST HUMANITY by @thermofisher—who is withholding the genetic formula to a critical PCR test probe that can be a lifesaving key **shortcut** test for new contagious #SARSCoV2 B117 variant w/out 🧬 sequencing. Faster test can save lives. Scientists are begging—🧵

https://twitter.com/nathangrubaugh/status/1344631146332745728

2) Background— gene sequencing for finding the mutated virus is much slower and more expensive. But we need to test likely hundreds of thousands or millions to track down the new B117 variant. UK 🇬🇧 stumbled upon a short cut when it realized a special PCR can find mutated signal!

https://twitter.com/drericding/status/1341378611551596544

3) This special shortcut PCR test is called the Taqpath- and made by @thermofisher. They refuse to release the primer probe sequence to this shortcut test that can quickly find the 69-70 deletion of new B117 variant with the “S gene dropout” signal. @JoeBiden should invoke DPA.

https://twitter.com/drblytheadamson/status/1344751284163899408

4) Using Defense Production Act would force the formula of this TaqPath test from @thermofisher. But that is still weeks away.

We actually only discovered the Colorado B117 variant case because of this “S gene dropout” PCR test.

Hence lives being endangered by its withholding.

https://twitter.com/drericding/status/1344041383213076487

5) How easy is it? The genetic sequence code can literally fit inside one line of a tweet: @K_G_Andersen thinks it’s this genetic sequence fragment code for the primer probe. But @thermofisher won’t confirm or share this **literally one line** of code!

TGGAAAAGAAAGGTAAGAACAAGTCC

https://twitter.com/k_g_andersen/status/1344666578843889667

6) What rich info can we graph and track if we could ramp up this test nationwide? This 👇 kind of rich data that UK 🇬🇧 has. But which @thermofisher is withholding. Shameful @ThermoFisherPR!!!

https://twitter.com/DrEricDing/status/1341378634955841537

7) We know this shortcut PCR test can be pandemic lifesaving because it predicts the B117 variant in the UK with 97% accuracy in early Dec. C’mon @thermofisher—do the right thing damnit! People will not forget your greed in times of the pandemic if you don’t @ThermoFisherPR.

https://twitter.com/drericding/status/1341378626185510912

8) Holy crap, according to UK 🇬🇧 researchers, by tracking the S Gene dropout PCR test, we estimate the new B117 variant has a R that is 1.74x high - for an R net increase of +0.9 to +1.6!!

Cmon @thermofisher, release the sequence & save lives!!! #COVID19

https://twitter.com/dgurdasani1/status/1344774568226004995?s=21

9) To be clear, @thermofisher did not “design” the TaqPath PCR test primers to the B117 variant. As @kakape of @ScienceMagazine points out, it was a “fortunate coincidence” it picked up the 69-70 deletion mutation in the variant. Dumb luck basically.

sciencemag.org/news/2020/12/m…

10) And do we have evidence @thermofisher has refused to help scientists? Oh yes, two scientists says that TF “wouldn’t tell us the target sequence of the probe” says @lea_starita, and TF “wouldn’t give us the probe sequence” says @NathanGrubaugh.

#thermofisherpandemicprofiteer

11) Ultimately, scientists will find a way and develop new PCR tests for the B117 variant. But the problem also is the time delay to validate a new test—since the TF one already has EUA. If TF shared, it would speed up worldwide detection of the more contagious variant. Shameful.